ID: 904260979

View in Genome Browser
Species Human (GRCh38)
Location 1:29287474-29287496
Sequence GTCTCCCCACTCTGAGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904260973_904260979 2 Left 904260973 1:29287449-29287471 CCACAGTCTAGCCCAGGGGAGTC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 904260979 1:29287474-29287496 GTCTCCCCACTCTGAGGTGTAGG 0: 1
1: 0
2: 0
3: 13
4: 161
904260969_904260979 20 Left 904260969 1:29287431-29287453 CCTGTCTTGTCTATATCTCCACA 0: 1
1: 0
2: 0
3: 16
4: 289
Right 904260979 1:29287474-29287496 GTCTCCCCACTCTGAGGTGTAGG 0: 1
1: 0
2: 0
3: 13
4: 161
904260968_904260979 21 Left 904260968 1:29287430-29287452 CCCTGTCTTGTCTATATCTCCAC 0: 1
1: 0
2: 2
3: 17
4: 228
Right 904260979 1:29287474-29287496 GTCTCCCCACTCTGAGGTGTAGG 0: 1
1: 0
2: 0
3: 13
4: 161
904260977_904260979 -10 Left 904260977 1:29287461-29287483 CCAGGGGAGTCGGGTCTCCCCAC 0: 1
1: 0
2: 0
3: 5
4: 95
Right 904260979 1:29287474-29287496 GTCTCCCCACTCTGAGGTGTAGG 0: 1
1: 0
2: 0
3: 13
4: 161
904260976_904260979 -9 Left 904260976 1:29287460-29287482 CCCAGGGGAGTCGGGTCTCCCCA 0: 1
1: 0
2: 1
3: 9
4: 87
Right 904260979 1:29287474-29287496 GTCTCCCCACTCTGAGGTGTAGG 0: 1
1: 0
2: 0
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904260979 Original CRISPR GTCTCCCCACTCTGAGGTGT AGG Intronic
903541402 1:24098463-24098485 GTGTTCCCAGTCTTAGGTGTGGG + Intronic
903928534 1:26848982-26849004 TTCCCCCAGCTCTGAGGTGTGGG + Intronic
903998742 1:27325171-27325193 GTCTACCCCCTCAGAGATGTTGG + Intronic
904260979 1:29287474-29287496 GTCTCCCCACTCTGAGGTGTAGG + Intronic
904901786 1:33863363-33863385 GCCTCCCCACTCTCATGTGAGGG - Exonic
905902135 1:41588668-41588690 TGCTCCCCACTCAGAAGTGTGGG - Intronic
906376665 1:45302000-45302022 CTCTGCCCACTCTGAAATGTTGG - Intronic
906953927 1:50357186-50357208 GTCACCCCCCTCTGAGGTTAGGG + Intergenic
915802039 1:158804059-158804081 GTCTCCCCTAACTGAGGTCTGGG + Intergenic
916085536 1:161266389-161266411 TTCACCCCACACTGAGGTTTAGG - Intronic
917733131 1:177896548-177896570 ATCTCCACACTCTGAGGAGATGG - Intergenic
919653997 1:200180186-200180208 GGCTTCACACTCTGAGGGGTAGG - Intergenic
920080117 1:203367046-203367068 GTTTTCCCACTCTGAGGAATTGG + Intergenic
920280747 1:204841790-204841812 GTCCCCCCATCCTGAGGGGTCGG + Intronic
920391910 1:205610300-205610322 GACACTCCACTCTGAGGTTTTGG + Exonic
921920023 1:220657822-220657844 GGCTCCTCACCTTGAGGTGTCGG - Exonic
922721874 1:227903671-227903693 GTGGCCCCACTCTGAGGTCTGGG + Intergenic
924385776 1:243496954-243496976 GTCGCCCCCCTCTGAGCTGCAGG + Intronic
1063093770 10:2890973-2890995 GTCTCACTACTGTGAGGTGTGGG - Intergenic
1064042023 10:11975106-11975128 GTCTCCCCAGTCAGGCGTGTTGG + Intronic
1064276450 10:13910343-13910365 CTCTCCCCTCTCTGAGGCCTGGG - Intronic
1066066666 10:31765923-31765945 GTTATCCCACTCTGAGGTGGGGG - Intergenic
1066260311 10:33723523-33723545 GTCTCCCCAAGCTGGGGTTTGGG - Intergenic
1067262620 10:44707459-44707481 GTGTCCCCACTCTAAGGCCTGGG + Intergenic
1067433035 10:46256476-46256498 GGCTCCCCACTGTGAGACGTCGG + Intergenic
1067440228 10:46304948-46304970 GGCTCCCCACTGTGAGACGTCGG - Intronic
1067730141 10:48804830-48804852 GTCTCTCCACTTTGTGGTTTGGG + Intronic
1072470209 10:95706756-95706778 GAGTCCCCACTCTGGTGTGTGGG + Intergenic
1075199987 10:120394628-120394650 TTCTCCCCACTCTGAGGACAGGG - Intergenic
1075918336 10:126189067-126189089 GTCTCCCTACTCTAGGATGTGGG - Intronic
1077992409 11:7423761-7423783 TTCCCCCCACTCTGAGATGATGG - Intronic
1079247784 11:18765758-18765780 GTCTCTCCATTCTGAGGTCTGGG + Intronic
1083620685 11:64048015-64048037 GCATCCCCACTCTGAAGTGGTGG - Intronic
1084766412 11:71311888-71311910 GTCTCCCCATCCTGTGGAGTGGG + Intergenic
1088991962 11:114961345-114961367 GCCTCACCTCTCTGAGGTGAGGG + Intergenic
1089615080 11:119690686-119690708 GTCTCCCCTCTGTGGGGTTTGGG - Intronic
1094514744 12:31120020-31120042 GCCTCCCCACTCTGCGATGGGGG - Intergenic
1095601084 12:44013817-44013839 GTCTCTCCAATTTGTGGTGTAGG + Intronic
1096573348 12:52537436-52537458 GACTCCCCTCTCTGTGATGTAGG - Intergenic
1100958955 12:99941617-99941639 GACTCTCAACTCTGAGGTGAAGG - Intronic
1101036936 12:100716183-100716205 GCCTCCCCACTCTTCGGTGAGGG - Intergenic
1102030228 12:109736092-109736114 ATCTCCCCGCTCTGAGGTTGGGG + Intronic
1102038079 12:109783436-109783458 GCCTCCCCACCCTGGGGTGGGGG - Exonic
1104091206 12:125519246-125519268 GTCAGCCTATTCTGAGGTGTGGG + Intronic
1105811607 13:24000991-24001013 TTCTCCCCACTCCGAGTTCTTGG + Intronic
1107360360 13:39611062-39611084 GTCTCCTCTCTCTGAGCTGTGGG + Intergenic
1107938120 13:45362018-45362040 GACTCCCCACACAGAGGTCTGGG - Intergenic
1112167747 13:96937553-96937575 CTCTCCCCACTCTGTGCTCTGGG - Intergenic
1114200502 14:20515546-20515568 GTCTCCCCACTGCCATGTGTGGG + Intergenic
1114367205 14:22041946-22041968 GTCTCTCCATTCTCAGGTGATGG + Intergenic
1115469117 14:33749614-33749636 GTCTGGCCACTATGAGTTGTTGG - Intronic
1117418468 14:55519692-55519714 GTCACCCCACTCTGAGCTCCAGG + Intergenic
1121009723 14:90512776-90512798 CTCTCCCCACACTGAGGGCTTGG - Intergenic
1122807783 14:104269279-104269301 GACTCCCCACCCCGCGGTGTGGG - Intergenic
1123014596 14:105367738-105367760 GTCTCCCCCGCCTGAGGAGTAGG - Intronic
1123632896 15:22274470-22274492 GTCCCCCCACTCTTAGGGGTTGG - Intergenic
1124239100 15:28015286-28015308 GTCTCCCCACTCTCAGGGACTGG - Intronic
1124960203 15:34388169-34388191 GTCTTCCCACTCTAAGCTCTGGG + Intronic
1124976832 15:34534390-34534412 GTCTTCCCACTCTAAGCTCTGGG + Intronic
1126009409 15:44288722-44288744 GCCTCCCAACCGTGAGGTGTTGG + Exonic
1127019702 15:54732439-54732461 ATCTTGCCACTCTGAGGAGTTGG + Intergenic
1127027984 15:54829240-54829262 GTTTCCCCAGTCTGAGATTTTGG - Intergenic
1127333198 15:57958500-57958522 GTCTCCCCACAGAGAGCTGTGGG - Intronic
1131516527 15:93081274-93081296 GGCTCCCCACAATCAGGTGTGGG - Intronic
1131826046 15:96323035-96323057 CTCTCCTCCCTCAGAGGTGTGGG - Intergenic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1135062558 16:19283329-19283351 GTCTCCCCACGCTAGGGTTTGGG + Intergenic
1136084874 16:27877646-27877668 GTCTCCCCACTCAGTGTTGCTGG - Intronic
1136116071 16:28095573-28095595 GTCTCCCCATTCTGAGGAAGGGG - Intergenic
1136497920 16:30655120-30655142 GTCTTCCCTCTCGGAGGAGTGGG + Exonic
1137764536 16:50967738-50967760 GCCTCCCCACTCAGAGCTGCAGG + Intergenic
1139312582 16:66040015-66040037 GTGTCCCCACCATGAGGTCTGGG - Intergenic
1140475551 16:75237873-75237895 GTCTCCCCATGCTGTGCTGTGGG - Intronic
1142150463 16:88510329-88510351 GGTTCCCCACTCTGTGGGGTTGG + Intronic
1142420988 16:89969876-89969898 GCCTCCCTGCTCTGTGGTGTTGG - Exonic
1146649258 17:34596668-34596690 GTCTCCCAGCCCTGATGTGTGGG + Intronic
1149753955 17:59172602-59172624 GCCCCCACACTCTGAGCTGTCGG + Intronic
1149893266 17:60408986-60409008 GTCTCCCCAAGCTGGGGTCTGGG - Intronic
1152574634 17:81134640-81134662 CTCGCCACACTGTGAGGTGTGGG - Intronic
1152638836 17:81441156-81441178 ATCTCCCATCTCTGAGGTGTGGG + Intronic
1157786937 18:50492131-50492153 GTCTCAGACCTCTGAGGTGTTGG - Intergenic
1160001834 18:75032115-75032137 CTCCCCCCACACTGAGGGGTTGG + Intronic
1162420856 19:10565481-10565503 ACCTGCCCACTCTGATGTGTGGG - Intronic
1163608802 19:18290660-18290682 GTCTGTCCACACTGAGATGTGGG + Intergenic
1166230872 19:41425351-41425373 CACTCCCCACTCTGAGGCCTGGG - Exonic
1168394001 19:56032923-56032945 GACTCCCCACTCTGTGCTTTTGG - Intronic
1168584532 19:57582360-57582382 GTCTCCCCAATATGGGGTTTGGG + Intronic
925154442 2:1638968-1638990 GTCTCCCAACACTGTGGTGAGGG + Exonic
927211563 2:20642137-20642159 GTCTCCCCCGACTGAAGTGTGGG + Intronic
929801623 2:45109402-45109424 GTCTTCCCATTCGCAGGTGTGGG - Intergenic
931450053 2:62360952-62360974 GTCTTCCCTGTCTGAGGTGGTGG + Intergenic
934702011 2:96449952-96449974 GTCTCCCCAGTTTGTGGTTTGGG - Intergenic
935246538 2:101223761-101223783 GTCTCCCTGCTCTGGGGAGTGGG + Intronic
937996218 2:127696887-127696909 GTCTCCCCAGTTTGAGGTCTGGG - Intergenic
942444910 2:176071433-176071455 TTCTCCCCACTCAGATGCGTGGG - Intergenic
945194749 2:207227601-207227623 CTTTCCCCACTCTGCAGTGTTGG + Intergenic
948465861 2:238151339-238151361 GGCTCCCCTCTCTGAGGTCTCGG - Exonic
948851228 2:240707505-240707527 GTCCCCCCAGTCTGGGGTGCAGG + Intergenic
1168979910 20:1995546-1995568 ATCTGCCCACACTGAGGGGTGGG + Intergenic
1169475004 20:5923261-5923283 CTCTCCTCACTCTGAGGTCTTGG - Exonic
1174198999 20:48794070-48794092 GTCCTCCCACTCTGTGGGGTAGG - Intronic
1180150632 21:45945471-45945493 GTCTTCCAACGCTGAGGTGGGGG - Intergenic
1181961451 22:26624897-26624919 CTCTGGCCACTCTGAGATGTGGG - Intronic
1185290796 22:50026352-50026374 GACCCTCCACTCTGAGGTGGTGG - Intronic
1185290816 22:50026462-50026484 GACCCTCCACTCTGAGGTGGTGG - Intronic
949635092 3:5974017-5974039 GTCTTTCCAGTCTGAGGTCTGGG + Intergenic
951190454 3:19763244-19763266 GTTTCCCCACTTTGAAGTGAAGG + Intergenic
952628033 3:35430246-35430268 GTCTCCCCAATCTCAGTTATTGG + Intergenic
953931069 3:47005930-47005952 GCCTCCCTACTCTCAGGAGTCGG + Exonic
954273946 3:49530554-49530576 GTCTCCCCACTGTGTGGCCTTGG + Intronic
956335439 3:68158247-68158269 GCCTCCCCACTCTGTGATGTGGG + Intronic
963344421 3:144077224-144077246 TTCTCCCCACATTGAGGTGGAGG + Intergenic
964412736 3:156415847-156415869 CTCTCCCCACTCTGAGTTACAGG + Intronic
964442188 3:156723372-156723394 GTCTACCCACTCTGTGAAGTAGG - Intergenic
965929357 3:174023550-174023572 GCCTCCCCACACTGAGATGATGG - Intronic
966179818 3:177177979-177178001 GTGTAACCTCTCTGAGGTGTTGG + Intronic
978252813 4:106653326-106653348 GTCTCCCCAAGCTGGGGTTTGGG - Intergenic
985765648 5:1778073-1778095 GTCTCCCGACTCTGACTTCTGGG - Intergenic
986217957 5:5738611-5738633 GTTGCCCCATTCTGAGGTCTGGG - Intergenic
988163476 5:27551771-27551793 GTCTCCCCGCACTGCTGTGTAGG - Intergenic
988373008 5:30396539-30396561 GTCTCCAGAGTCTGAGGTGCAGG - Intergenic
991939706 5:71838750-71838772 GTCTGCCACCTCTGAGGGGTAGG - Intergenic
995457758 5:112369902-112369924 GCTTCCCACCTCTGAGGTGTAGG + Intronic
995863218 5:116662852-116662874 GTCTCACCACTCTGATTTGAGGG - Intergenic
998773699 5:145574475-145574497 GCTGCCCCACTCTGAGGTGATGG + Intronic
999079589 5:148830246-148830268 GTCTCCACACTCAGAGATTTGGG + Intergenic
999274026 5:150316980-150317002 GACTCCCAACTCTCAGGTCTGGG + Intronic
1001087718 5:168713265-168713287 CTCTCTCCACCCTGTGGTGTAGG + Intronic
1004046416 6:12028256-12028278 GTGGCCCGGCTCTGAGGTGTTGG + Intronic
1004078678 6:12369502-12369524 AGCTGCCCACTCTGAAGTGTAGG - Intergenic
1004797020 6:19097917-19097939 GTCTGCCTACTCTGGAGTGTAGG + Intergenic
1007205809 6:40149552-40149574 GTTTCCCCAAGCTGAGATGTTGG - Intergenic
1007936443 6:45736893-45736915 ATCTGTCCACTCTGAGGTCTTGG - Intergenic
1007937033 6:45741593-45741615 TTCTGCCCACTCTGTGGTGAAGG + Intergenic
1008118080 6:47576548-47576570 ATCTCCACACTCTGAGTTTTGGG - Exonic
1011519844 6:88193457-88193479 CTCCCCCTACCCTGAGGTGTGGG + Intergenic
1013916092 6:115338742-115338764 TTCTCACCTCTCTGGGGTGTAGG + Intergenic
1017055479 6:150432046-150432068 GTCTCCCCAGTTGCAGGTGTGGG - Intergenic
1017205450 6:151800263-151800285 CTCTCCCTCCTCTCAGGTGTGGG - Intronic
1017525964 6:155241516-155241538 GTCTTCCAACTCTGACGTGCTGG + Intronic
1021190500 7:17613924-17613946 TTCTCCCCACTCTGCTGTCTAGG + Intergenic
1022307126 7:29157210-29157232 TCCTCCCCACTCAGAGGTGTGGG - Intronic
1023663166 7:42491444-42491466 GTCTTCAGACTCTGAGCTGTTGG - Intergenic
1028442440 7:90879880-90879902 GTCTCCCTTCTCTGGGGAGTGGG - Intronic
1028534638 7:91878908-91878930 ATCTCACCACTTTGAGATGTTGG + Intronic
1032391793 7:131559842-131559864 GTCTCCCCAGTTTGAGGCCTGGG + Intergenic
1033499999 7:141937793-141937815 GTCACCCCACTCCCAGGTCTGGG + Intronic
1034305096 7:150040806-150040828 GTCTCCCCACCCTGTGATGGGGG + Intergenic
1034305728 7:150043330-150043352 GTCTCCCCACCCTGTGATGGGGG + Intergenic
1034801115 7:154057320-154057342 GTCTCCCCACCCTGTGATGGGGG - Intronic
1034802074 7:154060864-154060886 GCCTCCCCACTCTGTGATGTGGG - Intronic
1035261654 7:157665459-157665481 CCCTCCCCACTCTGAGGAGCTGG + Intronic
1042823932 8:72961096-72961118 GGCTCCCCGCTTTGAGGTCTTGG + Intergenic
1044431571 8:92113836-92113858 GTTTCCCCTCACTGAGGTATTGG - Intergenic
1044964791 8:97564425-97564447 CTCTCCCCACGCTGAAGTGCAGG + Intergenic
1048208059 8:132431405-132431427 GTCCCCCGACTCTGAGGAGGTGG - Intronic
1048406357 8:134126585-134126607 GCCTCCCCACTCCCAGGTGTGGG - Intergenic
1049358647 8:142201323-142201345 GTCACCCCACACTGATTTGTGGG + Intergenic
1051480759 9:17557329-17557351 GACTCCCCACACTGAGGTCAAGG + Intergenic
1053592976 9:39533136-39533158 CTCTCCCTGCTCTGAGATGTTGG - Intergenic
1054573330 9:66832141-66832163 CTCTCCCTGCTCTGAGATGTTGG + Intergenic
1054597127 9:67078671-67078693 CTCTCCCCACTCTATGGTCTTGG - Intergenic
1055115977 9:72606018-72606040 GCCTCCACATTCTGAGGTGGTGG + Intronic
1055621639 9:78131767-78131789 GCCTCCCCACTTTTAGTTGTGGG - Intergenic
1058093968 9:100837785-100837807 GTCTCCCCACCAAGAGATGTTGG + Intergenic
1059780730 9:117523705-117523727 GGCTGCCCACTCTGAACTGTTGG + Intergenic
1062093840 9:134692660-134692682 GTCACCCAATTCTGGGGTGTGGG + Intronic
1188137196 X:26504851-26504873 GTATGCCCACTCTGGGGAGTGGG - Intergenic
1191059231 X:56277531-56277553 GTCAACCCACTCTCAGGTCTAGG - Intronic
1193673655 X:84419781-84419803 GTCACCCCACCCTCAGGTTTAGG + Intronic
1195557519 X:106243951-106243973 GTCTCCCCAGTTTGGGGTCTGGG + Intergenic
1198487451 X:137102446-137102468 GTCTTCCCAGTCTGAGCTGATGG + Intergenic
1199591956 X:149475854-149475876 GCATCCCCATTCTGAGCTGTTGG + Intergenic
1200241144 X:154494640-154494662 GTCTGCCCACTCTGAGTGGCTGG - Intergenic
1202130602 Y:21605371-21605393 GTTTCGCCACTCTGAGGTCATGG + Intergenic