ID: 904262809

View in Genome Browser
Species Human (GRCh38)
Location 1:29299745-29299767
Sequence CACTTTCCACAAAGAGCACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904262805_904262809 7 Left 904262805 1:29299715-29299737 CCAGGAGAGCTCTCTGTGGAGCT 0: 1
1: 0
2: 2
3: 31
4: 260
Right 904262809 1:29299745-29299767 CACTTTCCACAAAGAGCACGAGG 0: 1
1: 0
2: 0
3: 9
4: 102
904262803_904262809 17 Left 904262803 1:29299705-29299727 CCTTTCTCTGCCAGGAGAGCTCT 0: 1
1: 0
2: 2
3: 42
4: 280
Right 904262809 1:29299745-29299767 CACTTTCCACAAAGAGCACGAGG 0: 1
1: 0
2: 0
3: 9
4: 102
904262800_904262809 29 Left 904262800 1:29299693-29299715 CCCTCATTTGCTCCTTTCTCTGC 0: 1
1: 0
2: 11
3: 73
4: 705
Right 904262809 1:29299745-29299767 CACTTTCCACAAAGAGCACGAGG 0: 1
1: 0
2: 0
3: 9
4: 102
904262801_904262809 28 Left 904262801 1:29299694-29299716 CCTCATTTGCTCCTTTCTCTGCC 0: 1
1: 0
2: 7
3: 76
4: 654
Right 904262809 1:29299745-29299767 CACTTTCCACAAAGAGCACGAGG 0: 1
1: 0
2: 0
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904262809 Original CRISPR CACTTTCCACAAAGAGCACG AGG Intronic
901872046 1:12143845-12143867 CACTTCCTCCAGAGAGCACGTGG - Exonic
901988912 1:13096726-13096748 CACCTTCCACAGAGGGCACCTGG - Intergenic
901992901 1:13130041-13130063 CACCTTCCACAGAGGGCACCTGG + Intergenic
904262809 1:29299745-29299767 CACTTTCCACAAAGAGCACGAGG + Intronic
911174143 1:94802451-94802473 CACCGTCCACAAGGAGCACTTGG + Intergenic
913533012 1:119746499-119746521 CACATGCCACAAAGAACATGAGG - Intergenic
920708298 1:208271404-208271426 CACTTGGCACAAGGAGCATGGGG + Intergenic
923365616 1:233258256-233258278 CACTGTCCACACTGAGCACCCGG + Exonic
1063188413 10:3670765-3670787 CACTATCCCCAGAGAGCACAAGG + Intergenic
1065193020 10:23232521-23232543 CACTATTCACACAGAGCACTGGG + Intronic
1067782897 10:49221822-49221844 CTCTTCCCACAAACAGCACATGG - Intergenic
1068168963 10:53368861-53368883 CATATTCCAGAAAGAGCCCGAGG - Intergenic
1069847074 10:71379818-71379840 CAGTGTCCACAAAGTGCACTCGG - Intergenic
1073578778 10:104645141-104645163 CACTTTCCAGCCAGAGCACCTGG - Intronic
1075926103 10:126252902-126252924 CCCTTTCTACAAGGAGCAGGAGG - Intronic
1077445587 11:2589176-2589198 CACTTTCCAACCAGAGCCCGTGG - Intronic
1077540350 11:3143716-3143738 CTCTTTCCCCAAAGAGCCCCAGG - Intronic
1079085397 11:17441241-17441263 TATTTTCCACAAAGAGCTGGGGG - Intronic
1088139165 11:106595009-106595031 AACTCTGCACAAAGAGCAAGAGG - Intergenic
1088642151 11:111883188-111883210 CACTTTCAACACATAGTACGTGG + Exonic
1089289992 11:117431792-117431814 CACTTACCAGAAAGGGCAGGGGG + Intronic
1090653101 11:128824122-128824144 CCCTTTCCACAAAGACCACTTGG - Intergenic
1099914380 12:88873975-88873997 CAGTTTTTACAAAGAGCACGAGG + Intergenic
1101010185 12:100441447-100441469 CAGTTTCTAGAAAGAGCAGGAGG - Intergenic
1103852984 12:123945501-123945523 CCCTTTCCACAGCAAGCACGCGG - Intronic
1105829757 13:24153554-24153576 CACTTTCAACAGAGGACACGTGG + Intronic
1110462777 13:75764337-75764359 TACTCTCCACAAAGAAAACGTGG + Intronic
1112571452 13:100597223-100597245 CACGTTGTAAAAAGAGCACGTGG - Intergenic
1113851402 13:113420775-113420797 CACTTCCCACAAAACGAACGGGG + Intergenic
1117443390 14:55780543-55780565 CACCTTCCAGAAAGAACACAAGG + Intergenic
1117736119 14:58770605-58770627 CACTTACCAGATAGAGCAAGGGG - Intergenic
1118334609 14:64842313-64842335 CAGTTTCCAGAAAGAGCCAGAGG + Intronic
1121991530 14:98562341-98562363 CACTTCACACAAAGAGGAAGAGG - Intergenic
1122626366 14:103087327-103087349 CACCTTCCCAAAAGAGCACAAGG - Intergenic
1129972838 15:79795461-79795483 CACTTTCCTCAAAGAGAACTTGG - Intergenic
1131087646 15:89590143-89590165 CACTTTCAAGAAAGTGCACGTGG + Intronic
1131303823 15:91223872-91223894 CATTTTCCACAAATAACACACGG - Intronic
1132932630 16:2466803-2466825 CACTGTCCACACAGAGCACCTGG - Intergenic
1137572187 16:49574021-49574043 CACTTTCCTTAAAGATCACCTGG - Intronic
1138336690 16:56258966-56258988 CACTTTCCATAAAGAACAAAGGG - Intronic
1138961859 16:62037043-62037065 CATTTTCCCAAAGGAGCACGGGG - Intergenic
1145817143 17:27803771-27803793 CCCTTTTGACAAAGAGCAAGTGG + Intronic
1146976279 17:37115078-37115100 CACATTCCACATAGAGTAGGGGG - Intronic
1153586447 18:6625669-6625691 CACTTTCCAGTGAGAACACGTGG + Intergenic
1157483181 18:48069010-48069032 CAGTCTCCACTAAGGGCACGTGG + Intronic
1160355183 18:78221677-78221699 CACATTCCTCAAATAGCACAAGG + Intergenic
1165132777 19:33643167-33643189 CACCTTCCAGAAAGACCAAGCGG + Intronic
1167388172 19:49176936-49176958 CACTTTCCACAGAGAGAAACTGG - Intronic
925689271 2:6504764-6504786 CAGTTTCCACACTGAGCACGTGG + Intergenic
927089181 2:19697610-19697632 CACATTGCAAAAAGAGCGCGTGG + Intergenic
930179711 2:48341654-48341676 CACTTCCAAGAAAGAGCATGTGG + Intronic
933473455 2:82757748-82757770 CATTTTCCTCAAAGAGCATGTGG - Intergenic
936896656 2:117435341-117435363 CACATTCCACAAGCAGCACAAGG + Intergenic
942453882 2:176124684-176124706 CCCTTTCCTCAGGGAGCACGCGG + Exonic
944050553 2:195463806-195463828 CTCTATCCAGATAGAGCACGGGG + Intergenic
948571530 2:238920780-238920802 CTCTTCCCTCAAAGAGCACAGGG - Intergenic
1173390180 20:42624807-42624829 CACATTCCACAAAGGGCTTGAGG + Intronic
1174298169 20:49563345-49563367 CACTGTGCATAAAAAGCACGTGG + Intronic
1174909962 20:54597006-54597028 CACTTTACACAAAGCTCACAGGG + Intronic
1175517697 20:59579330-59579352 CACTTTCCCCAAGGAGAAAGCGG + Intronic
1178098935 21:29245109-29245131 CACTTGCCACAATGGGCACAGGG - Intronic
1179099146 21:38341531-38341553 CCCTTTCCCCAAAGAGAACAAGG - Intergenic
1179639212 21:42736160-42736182 CACTTTCCGGGAAGAGCATGGGG - Intronic
1181029964 22:20144926-20144948 CACTGGCCACAGAGAGCATGGGG - Intronic
1181513301 22:23398380-23398402 CACTGGCCACAGAGAGCATGGGG + Intergenic
1181625611 22:24120272-24120294 CGCTTTCCAAAAAGAGCTGGAGG - Intronic
1183469787 22:37999165-37999187 CATTTCCCACAAGGAGCACCTGG - Intronic
1184984748 22:48122245-48122267 CACATGACACAGAGAGCACGCGG + Intergenic
950823357 3:15787414-15787436 CACTGGCCACAAAGAGCTGGAGG + Intronic
954859089 3:53672312-53672334 CCCATTCCCCAAAGAGCCCGTGG + Intronic
956258871 3:67314910-67314932 TACTTTTCACAAAGAGAAAGGGG + Intergenic
956478101 3:69644909-69644931 GACATTCCATAAAGAGCATGTGG + Intergenic
959225204 3:103572654-103572676 CATTTTCCAGAAAGAGCCCTTGG + Intergenic
973941684 4:55917337-55917359 CACTTTGTAAAAAGAGCATGTGG + Intergenic
974604448 4:64132856-64132878 CACTTTCCACAAACTGCACATGG - Intergenic
983430862 4:167648970-167648992 CACTTTTCACAAAGAACAAATGG + Intergenic
984949306 4:184994868-184994890 AACTTGGCACAAAGAGCAGGGGG + Intergenic
987185843 5:15418209-15418231 TTCTTTCCCCAAAGAGCTCGTGG - Intergenic
987842109 5:23235079-23235101 CAGTTTGCACAGAGAGCAAGAGG + Intergenic
988763940 5:34349687-34349709 CACCTTCCACAATGATCATGAGG - Intergenic
995439955 5:112180429-112180451 CACTTTCAACAAAGGCCACAAGG + Intronic
996606526 5:125329556-125329578 CATTATCCACAGAGAGCAGGAGG + Intergenic
1000219505 5:159199404-159199426 CACTTTCAAGAAAGAGGAAGTGG + Intronic
1004424908 6:15500695-15500717 CACTTGCTACGAAGAGCAGGTGG - Intronic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1004989801 6:21124656-21124678 CAATGGCCACAAAGAGAACGAGG + Intronic
1012115099 6:95286535-95286557 AACTTTCCAAAAATAGCAGGAGG + Intergenic
1014368055 6:120569835-120569857 TTCTTTCCACCAAGAGCACATGG + Intergenic
1016092346 6:139994985-139995007 CACTTTGTGCAAAGAGCACCAGG - Intergenic
1022818701 7:33937930-33937952 CACATTCCAGAAGGAGCATGTGG - Intronic
1030544477 7:110874913-110874935 CTTTTTCCACACAGAGCAGGAGG + Intronic
1031570319 7:123351164-123351186 GGCTTTCCACAAAGAGCTCAGGG - Intergenic
1033874160 7:145793883-145793905 CACTTACCATAAATAGCATGAGG - Intergenic
1035458376 7:159023970-159023992 TTCTCTCCACACAGAGCACGTGG + Intergenic
1035950790 8:4018467-4018489 TACTTTGCACAAGGAGCAGGTGG + Intronic
1037445318 8:18959622-18959644 CACATTCCACTAAGAGAACTGGG + Intronic
1038376926 8:27049018-27049040 CACTTGCCACAAAAAGCAGGGGG + Intergenic
1042185759 8:66135073-66135095 CACCTTGCACAGAGAGCAGGTGG - Exonic
1045256754 8:100531484-100531506 CTCTTTCCACAGAGAGCCCATGG - Intronic
1045347629 8:101308489-101308511 CAATTTCTACAAAGAGCCTGGGG + Intergenic
1047620018 8:126596695-126596717 CACTTTCAACAAAAAGAATGTGG - Intergenic
1048436419 8:134422862-134422884 TACTTTCCACAAAGGGCTCTGGG + Intergenic
1049379032 8:142302880-142302902 CACTGTCCACCAAGAGCAGCTGG + Intronic
1050623449 9:7478447-7478469 CCCATTTCACAAAGAGAACGAGG + Intergenic
1057803039 9:98201535-98201557 GACTGTCCGCAAAGACCACGAGG + Exonic
1185540427 X:898974-898996 CAGTTCCCTCAAAGAGCAGGGGG - Intergenic
1187936923 X:24345301-24345323 CAGTTTGCACAGAGAGCAAGAGG + Intergenic
1189102427 X:38205241-38205263 CACTTCCCTAAAAGAGCAGGTGG + Intronic
1191805982 X:65134261-65134283 GACTTGCCACCAAGAGAACGTGG + Intergenic
1192450682 X:71242861-71242883 CACTCTTCACAAAGGGCCCGAGG - Intronic
1200002083 X:153067335-153067357 CTCTTTCCACAAAAGGCAAGAGG + Intergenic
1200005650 X:153082690-153082712 CTCTTTCCACAAAAGGCAAGAGG - Intergenic