ID: 904263191

View in Genome Browser
Species Human (GRCh38)
Location 1:29303128-29303150
Sequence TGGGCGTGCGTGTCCCAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904263186_904263191 16 Left 904263186 1:29303089-29303111 CCCTGTTGTTAAGCGATGCATAA 0: 1
1: 8
2: 78
3: 175
4: 507
Right 904263191 1:29303128-29303150 TGGGCGTGCGTGTCCCAAGGCGG 0: 1
1: 0
2: 1
3: 7
4: 102
904263187_904263191 15 Left 904263187 1:29303090-29303112 CCTGTTGTTAAGCGATGCATAAG 0: 1
1: 0
2: 15
3: 117
4: 334
Right 904263191 1:29303128-29303150 TGGGCGTGCGTGTCCCAAGGCGG 0: 1
1: 0
2: 1
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904263191 Original CRISPR TGGGCGTGCGTGTCCCAAGG CGG Intronic