ID: 904265697

View in Genome Browser
Species Human (GRCh38)
Location 1:29317513-29317535
Sequence CTGAGGTTATGTGGGTGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904265690_904265697 26 Left 904265690 1:29317464-29317486 CCCTATTTCACAGTCGAGGAAAC 0: 1
1: 1
2: 57
3: 617
4: 3086
Right 904265697 1:29317513-29317535 CTGAGGTTATGTGGGTGGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 229
904265691_904265697 25 Left 904265691 1:29317465-29317487 CCTATTTCACAGTCGAGGAAACT 0: 1
1: 6
2: 309
3: 2215
4: 7251
Right 904265697 1:29317513-29317535 CTGAGGTTATGTGGGTGGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904265697 Original CRISPR CTGAGGTTATGTGGGTGGCA AGG Intronic
900253147 1:1682173-1682195 CAGAGGTCATGCGGGTGACAGGG + Intronic
900489258 1:2938756-2938778 CTGAGGGTCTGTGGGGGTCATGG - Intergenic
900541105 1:3203304-3203326 CAACGGTTGTGTGGGTGGCAAGG - Intronic
902301337 1:15504822-15504844 CAGAGGTTTTGTGGGAGCCAAGG + Intronic
902367614 1:15987544-15987566 ATCAGGGTATATGGGTGGCAGGG - Intergenic
903184484 1:21621700-21621722 CTGAGGTTGTGTGGCTGACCTGG - Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904265697 1:29317513-29317535 CTGAGGTTATGTGGGTGGCAAGG + Intronic
905872449 1:41412880-41412902 CTGAGGTTAGCCTGGTGGCAGGG - Intergenic
906118917 1:43374520-43374542 TTGTGGTGATGTGGGGGGCAAGG + Intergenic
906519612 1:46459325-46459347 TTGAGGTTATGTGGAGGGCTGGG - Intergenic
908775741 1:67638306-67638328 CTTAGCTTTTGTGGGTGCCATGG - Intergenic
911423160 1:97671760-97671782 CTGTGTTTGTGTGGGTGACAGGG + Intronic
914245176 1:145880185-145880207 CTTGGGTTTTGTGGGTGGTAGGG + Intronic
915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG + Intronic
916962994 1:169907907-169907929 CTGAGGGCATGTAGGTGGGAAGG - Intergenic
919370322 1:196716377-196716399 CTGAGGCTAGATGGGAGGCAAGG + Intronic
919656649 1:200203187-200203209 CTGAGGTCTTGTGGCAGGCATGG - Intergenic
920593841 1:207248812-207248834 CAGAGGCTGTGTGGGTCGCAGGG - Intergenic
922030663 1:221794423-221794445 CTGATGTCATGCTGGTGGCAGGG + Intergenic
922510314 1:226160679-226160701 CTGAGTTTGTAGGGGTGGCATGG - Intronic
1063450725 10:6148282-6148304 CTGTGGTTAGGTTGGTGCCATGG + Intronic
1064934239 10:20662341-20662363 TTGAGGATGTGTGTGTGGCATGG - Intergenic
1065360628 10:24885975-24885997 CAGGGGTTAGGTGGGAGGCAGGG + Intronic
1067177683 10:43961753-43961775 CACAGGAGATGTGGGTGGCATGG - Intergenic
1067770130 10:49116611-49116633 GTGAGGAGGTGTGGGTGGCATGG + Intergenic
1069751173 10:70745879-70745901 CTGGGGTCATGGAGGTGGCAGGG + Intronic
1070958970 10:80485722-80485744 CCGAGGTTAGGTGGGTGGCAGGG + Intronic
1071486038 10:86103414-86103436 CTGAGGCTGAGAGGGTGGCAGGG - Intronic
1071719712 10:88131122-88131144 CTGAGGGGATGTGGGTGGAGTGG + Intergenic
1072152794 10:92696561-92696583 CTGAGGTTAGGTGGGTGTGGGGG + Intergenic
1072255069 10:93613309-93613331 CCGGGGGAATGTGGGTGGCAGGG + Intronic
1073453094 10:103621073-103621095 CTGTGGATATGTGGGTGTCAGGG + Intronic
1073759473 10:106613947-106613969 CTGAGGTTGGGTGGTTGGAAAGG - Intronic
1073926979 10:108527839-108527861 CTGAGGCTATGTGATGGGCATGG + Intergenic
1074475548 10:113770668-113770690 CTGAGGTGAGGTGTTTGGCATGG - Intronic
1075189766 10:120296382-120296404 CAGAGTTTATGTGTATGGCAAGG - Intergenic
1075725463 10:124608546-124608568 CTGAGGTCACGTGGCTGGTAGGG + Intronic
1076075892 10:127533614-127533636 CTGAGATGAGGTGGTTGGCAAGG + Intergenic
1076195941 10:128518343-128518365 CAGAGGTTATGTGGAGGGGAGGG - Intergenic
1076303576 10:129447062-129447084 CTGAGGTTTTGTAGATTGCAGGG - Intergenic
1078606764 11:12784072-12784094 CAGAGGTTATGGGAGTGACAAGG + Intronic
1080622476 11:33998071-33998093 CTGAGAGTATGGGGGTGGCAGGG + Intergenic
1087291919 11:96329375-96329397 CTGAAGTTATGTGGGGGACAAGG - Intronic
1088830629 11:113533307-113533329 CAGAGGTGATGAGGGTGACAGGG - Intergenic
1089204476 11:116748454-116748476 CTGAGGCTGTGGGGGTGGCTGGG - Exonic
1089460930 11:118653094-118653116 TTGAGGATAGGTGGGTGGTAAGG + Intronic
1090063575 11:123484669-123484691 CTGAGGTTTTGGGGGTTGGAGGG - Intergenic
1091610479 12:2003898-2003920 CTGTGGCTATGGGGGAGGCAGGG - Intronic
1093648601 12:21617658-21617680 CTGGCGTGCTGTGGGTGGCACGG + Intergenic
1094252373 12:28378837-28378859 CTGAGGTTAAGTTGGTGGGAGGG - Intronic
1094594640 12:31854041-31854063 CTTATGTAATGGGGGTGGCAGGG + Intergenic
1095127981 12:38504556-38504578 CTGAAGTTCTGTGTGTGCCAGGG - Intergenic
1096395114 12:51260180-51260202 CTGAGTTCATCTGGGTGTCATGG + Intronic
1096476989 12:51914325-51914347 CTGGGGTTCTGTGGGTGGGGTGG + Intronic
1098059721 12:66548588-66548610 CAGAGGCTATGTGGATGACATGG + Intronic
1098355995 12:69613087-69613109 CTGAGGGTTTGTGGGTGATAGGG + Intergenic
1098881774 12:75924843-75924865 CTGAGCACATGTGGGAGGCAGGG - Intergenic
1100820635 12:98426267-98426289 GTGAGCTTATCTGGGTGGCCTGG - Intergenic
1101898785 12:108775705-108775727 CTGAGTGTCTGAGGGTGGCAAGG - Intergenic
1102217196 12:111169884-111169906 CAGAGGGCATGAGGGTGGCAGGG + Intronic
1103476138 12:121220201-121220223 CTGAGATAATCTGGTTGGCAGGG + Intronic
1103973588 12:124687799-124687821 CTGAGGTCATATGGCTGGGAAGG - Intergenic
1105008522 12:132738368-132738390 GTGAGGTTCTGTAGGTTGCACGG + Intronic
1106449980 13:29872252-29872274 CTTAGACTATGTGGGTGGGAGGG + Intergenic
1113013880 13:105805251-105805273 TTGAGGTCATGTCTGTGGCAAGG + Intergenic
1113015355 13:105822843-105822865 CTGGGATTATGAGAGTGGCAGGG - Intergenic
1114996355 14:28357244-28357266 CAGTGGTTATGTGAGTGTCAAGG + Intergenic
1116900476 14:50357849-50357871 GGGAGGGCATGTGGGTGGCATGG - Intronic
1118066359 14:62195526-62195548 CTGAGGATATGTGGTAGGAAGGG - Intergenic
1121338530 14:93091708-93091730 CTGAGGTTAAATGGGAGGCGGGG - Intronic
1122337409 14:101002891-101002913 CTTAGGCTGTGTTGGTGGCAGGG + Intergenic
1124126008 15:26938645-26938667 CAGAGGGTATGTTGGTAGCAAGG - Intronic
1126962552 15:54013836-54013858 CTTAGGTCATATGGGTAGCAAGG + Exonic
1128403528 15:67311110-67311132 CTGAGGTTGTGTGGTAAGCAAGG + Intronic
1129519803 15:76178528-76178550 CTGAGGTGAGGTGTGCGGCAGGG - Intronic
1129713470 15:77833402-77833424 CTGTGGTCAAGTGGGTGGGAAGG - Intergenic
1132505073 16:304002-304024 CTGATCCTTTGTGGGTGGCAGGG - Intronic
1133562567 16:6963638-6963660 CAGAGATTATGTGGGAGGGAGGG + Intronic
1134081674 16:11328965-11328987 ATGGGGTTAGGTGGGAGGCAGGG - Intronic
1134212156 16:12286781-12286803 CTGAGGTTTGATGGGTGGGACGG - Intronic
1134767553 16:16774200-16774222 GTCAGGATATGTGGGTGTCAGGG + Intergenic
1138375625 16:56562107-56562129 CTGAGCTTAGGTTGGTGACAGGG - Intergenic
1139538452 16:67595004-67595026 GTGAGGTTGGGTGGGTGGAAGGG + Intronic
1140281167 16:73556585-73556607 CTGGGGTTTTCAGGGTGGCAGGG + Intergenic
1140472856 16:75224885-75224907 CTGAGGCTCTGTGGGGAGCAGGG - Exonic
1143786060 17:9256656-9256678 CTGTGGTTATGTGGGTAGTGGGG - Intronic
1145266542 17:21382375-21382397 CTGAGGGGATGGGGCTGGCAGGG + Intronic
1146639981 17:34533103-34533125 GTGAGGTCCTGTGGGTGGGATGG - Intergenic
1147157184 17:38549872-38549894 CTGAAGGTGTGTGTGTGGCATGG - Intronic
1147708033 17:42441552-42441574 CTGGGGTGTTGGGGGTGGCAGGG - Intergenic
1148703762 17:49609697-49609719 CTGAGGATAAGTGGGAGGAAAGG + Intronic
1150137050 17:62701865-62701887 CTGTGGCCATGTGGGTGGCTGGG - Intronic
1152595029 17:81233772-81233794 CGGAGCTGATATGGGTGGCAGGG - Intronic
1153482833 18:5564778-5564800 CTGGGGTCCTGTTGGTGGCAGGG - Intronic
1153608558 18:6858485-6858507 TTGTAGTTATTTGGGTGGCAGGG + Intronic
1153873718 18:9345891-9345913 CTGGGGATATGTGGGGGGAATGG - Intronic
1154471889 18:14711800-14711822 CCGAGAATATCTGGGTGGCATGG - Intergenic
1156286400 18:35700425-35700447 CCCAGGTGAGGTGGGTGGCATGG - Intronic
1157559409 18:48636090-48636112 CTCAGGGGATGTGAGTGGCAGGG + Intronic
1158561055 18:58513963-58513985 CTGTGGTTCTGTGTGTGGTAGGG + Intronic
1158586010 18:58735666-58735688 TTGAGGGTGGGTGGGTGGCATGG + Intronic
1158631470 18:59118821-59118843 TTGAGGGTGTGGGGGTGGCAGGG - Intergenic
1160398194 18:78587725-78587747 GTGAGGTTATCTGAGTGCCAGGG - Intergenic
1160714570 19:570540-570562 CAGCGGGGATGTGGGTGGCAAGG + Intergenic
1160859871 19:1233248-1233270 CTGAGGTTCTGCAGGTGGCTGGG - Intronic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1162004671 19:7769854-7769876 ATGAGGTGATGTGGGAGGCTTGG - Intergenic
1165404929 19:35623745-35623767 CTGAGGGAAGGTGGGTGGCAGGG + Exonic
1165575071 19:36808557-36808579 CCGAGGATGGGTGGGTGGCAGGG - Intergenic
1165599790 19:37044368-37044390 CCGAGGATCGGTGGGTGGCAGGG + Intronic
1166083539 19:40459956-40459978 CTGAGGTTCTGAGGGGGACATGG + Intronic
925171934 2:1755256-1755278 CTGAGGATATGAGGGTGACGGGG + Intergenic
926751045 2:16198799-16198821 CTGGGGTAATGGGGGAGGCATGG + Intergenic
927436500 2:23071017-23071039 ATGTGGTGAGGTGGGTGGCAGGG + Intergenic
927641734 2:24849801-24849823 CTGAGGCTTGGGGGGTGGCAGGG - Intronic
931429357 2:62196583-62196605 CTGAGGTTGGGTGGCTGGGACGG - Intronic
931787041 2:65629480-65629502 CTCAGGCTATGCTGGTGGCAGGG + Intergenic
932751624 2:74375001-74375023 CTGTGGGTAGGTGGGTGGCGGGG - Intronic
935280455 2:101513003-101513025 CTGAGGTTATGTGGTCAGCCAGG + Intergenic
937527966 2:122794324-122794346 CTGAGGGTGTGGGAGTGGCAGGG + Intergenic
938757659 2:134395712-134395734 CTGAGGCTAAATGGGTGGTACGG - Intronic
938764885 2:134454135-134454157 CTGTGCTTATGTGGTGGGCAGGG + Exonic
939359486 2:141150047-141150069 GTGAGGTTGTGAGGGTGGGAGGG + Intronic
940301064 2:152176588-152176610 CAGAGAATATGTGGGTGGGAAGG - Intergenic
942686513 2:178538355-178538377 CTGAGGTTGTGTGCTTGGAATGG + Intronic
944347044 2:198681406-198681428 CTAAGGTTAGGAGAGTGGCAAGG + Intergenic
944580698 2:201130165-201130187 CTGAGGCTGGGTGGGTGGGAGGG + Intronic
946739177 2:222785138-222785160 CTGAGGTTATGTTGGTGTGCAGG - Intergenic
948706200 2:239794230-239794252 CATGGGTTATGTGGATGGCAAGG + Intronic
948825918 2:240573421-240573443 CTGAGGGCACATGGGTGGCAGGG - Intronic
949043541 2:241860078-241860100 GTGAGGCTGTGTGGGTGGCTTGG + Intergenic
1168782404 20:504672-504694 CTTAGGTGATGTGAGTGGTAGGG - Intronic
1169075525 20:2757599-2757621 CTGAAGGTATGTGGGTGGGAAGG + Intronic
1169477192 20:5942388-5942410 CTGAGATTATGGGGGTGGTGGGG + Intronic
1170516001 20:17130951-17130973 CTAAGGTGATGTTGGTGGGATGG - Intergenic
1171467389 20:25339658-25339680 CTGATGTCAGGTGGGGGGCATGG - Intronic
1172696318 20:36825599-36825621 CTGAGCTGATGTGGTTGCCATGG - Intronic
1173614061 20:44391217-44391239 CTCAGGTGGTGCGGGTGGCAGGG - Intronic
1174257028 20:49264453-49264475 CAGAGGTGCTGTGGGTGGTATGG + Intronic
1174680883 20:52407203-52407225 CTGAGCTAATGTGGAAGGCATGG - Intergenic
1175213742 20:57378485-57378507 CTGAGGTTACGGGGTGGGCAAGG - Exonic
1175574037 20:60047028-60047050 CGGAGATTATGTGTGTTGCAGGG + Intergenic
1176802602 21:13446089-13446111 TTGAGAATATCTGGGTGGCATGG + Intergenic
1178172165 21:30053530-30053552 CTCAGTTTTTGTGAGTGGCAAGG - Intergenic
1178485084 21:33014059-33014081 CTGATGTGAAGTGGGTGGCATGG - Intergenic
1179820595 21:43934801-43934823 TAGAGGTGGTGTGGGTGGCATGG - Intronic
1179820614 21:43934899-43934921 CAGAGGTGGTGTGGGTGGCATGG - Intronic
1182094693 22:27618142-27618164 CTGAGGTTATATTGGAGGAAGGG + Intergenic
1184273266 22:43396756-43396778 CTGGGGTGATGTGGCAGGCAGGG + Intergenic
1185142959 22:49113481-49113503 CTGTGGTTCTGTGGAGGGCAGGG - Intergenic
949577014 3:5348341-5348363 CTGAGTCTCTGTGGGTGGAAAGG - Intergenic
950758469 3:15198384-15198406 CTGGAGTTATGGGGGTGACAAGG - Intergenic
952207766 3:31197748-31197770 CTGAGGGTTGGGGGGTGGCAGGG - Intergenic
952678706 3:36065629-36065651 CAGATGTTATGTGGGTAGGATGG + Intergenic
952857560 3:37784813-37784835 CTGTGTTTATGTGGGTGCCTGGG + Intronic
953891642 3:46755796-46755818 CTGAGGGGATGTGGTTGGGAGGG - Intronic
954248770 3:49352502-49352524 CTGAGATGGTGGGGGTGGCATGG + Intergenic
954883796 3:53854609-53854631 CTGGTGTCATGTGGGTGCCATGG - Intronic
962240672 3:133748315-133748337 CTGAGGGGATGTGGCTGTCAAGG + Intronic
969182693 4:5454325-5454347 CTGAGATGAAGTGGTTGGCAGGG + Intronic
969323236 4:6425686-6425708 CTGTGGTGATGGGGATGGCAGGG - Intronic
969893513 4:10281340-10281362 ATGAGGTCAAGTTGGTGGCAGGG + Intergenic
969941330 4:10734864-10734886 CTGAGTTGAGGTGGGTGGCGGGG + Intergenic
971599650 4:28576065-28576087 CAGAGGTTCTGGGGGTTGCAGGG - Intergenic
975956383 4:79845015-79845037 TTGAGGTTGTGGGGGTGGGAAGG + Intergenic
976274649 4:83263929-83263951 CTGAAGTTATGGGGATTGCACGG - Exonic
976770154 4:88642910-88642932 CGGGGGGTGTGTGGGTGGCAGGG + Intronic
976827340 4:89275452-89275474 CTTAGGTTATGTGGGTATCTTGG + Intronic
976902699 4:90198206-90198228 CTGAAGTTGTGTGGGTGGGTGGG + Intronic
977675776 4:99745213-99745235 GTGTGGTTGTGTGGGTGTCAAGG - Intergenic
979859209 4:125672836-125672858 CTGAAGACATGTGGGTGGTAAGG + Intergenic
980092301 4:128455482-128455504 CAGAGGGTATGAGGGTGTCAAGG - Intergenic
981102887 4:140849903-140849925 CTGAGAATGTGTGTGTGGCATGG + Intergenic
982505166 4:156207992-156208014 ATGAGTTTATGAGGGTGTCAAGG + Intergenic
983074784 4:163312739-163312761 CTGTGTGTATGGGGGTGGCAAGG - Intergenic
986739248 5:10691679-10691701 CTGAGGATATGGGGCGGGCAGGG - Intronic
989129762 5:38095342-38095364 CTGAGGTTTAGGAGGTGGCAGGG - Intergenic
989788689 5:45364246-45364268 CTGAAGTCATGTGAGTGGGAAGG - Intronic
991162550 5:63521176-63521198 CTGAGGTTCTGGGTGTGGTAAGG - Intergenic
992816170 5:80441656-80441678 CTGAGATTATGTGAGTTTCAAGG + Intronic
994054769 5:95402770-95402792 CTGAGGTTAAGAGGGTCCCAGGG - Intronic
994656978 5:102606291-102606313 CTGAATTTATGTGGTTGACATGG + Intergenic
994830852 5:104782244-104782266 CTGAGATTGTCTGGGTGTCATGG - Intergenic
994977076 5:106821922-106821944 GTGAGATTATCTGGGTGGCGGGG + Intergenic
998369293 5:141650807-141650829 GTGTGTTTATGTGGGTGGGAGGG + Intronic
999230047 5:150056391-150056413 CTGAGGTGAGGAGGATGGCAGGG + Intronic
1000914293 5:167061315-167061337 CTGAGAATATGTGGTTTGCAAGG + Intergenic
1001455823 5:171858876-171858898 CAGAGGGTCTGTGGGTGCCAAGG + Intergenic
1001892327 5:175349979-175350001 CAGAGGTGATGTTGGAGGCAGGG + Intergenic
1002259410 5:177983466-177983488 CCCAGGTTATGTGGATGTCAGGG - Intergenic
1002271504 5:178075528-178075550 ATGAGGTTAAGTGGGTGGGGAGG + Intergenic
1003000923 6:2332081-2332103 CAGAGGTGATGTGGAGGGCAGGG + Intergenic
1005421322 6:25654312-25654334 GGGAGGGTATGTGGGGGGCAGGG + Intronic
1007801287 6:44395697-44395719 CTGGGGTGGTGTGGGAGGCACGG + Intronic
1009823928 6:68841873-68841895 GTGAGGGTGTGTGTGTGGCAAGG + Intronic
1014989212 6:128053238-128053260 CAGAGATTACGTGTGTGGCAGGG - Intronic
1020419118 7:7980295-7980317 CTGAGGAGAAGTGGGTGCCATGG + Intronic
1022188732 7:27996422-27996444 CTGAGAGGATGTGGGTGGGAAGG + Intronic
1023025128 7:36042947-36042969 CAGAGATTATGAGGGAGGCAGGG - Intergenic
1025299916 7:57810594-57810616 CTGAGGATGGGTGGGTGACAGGG + Intergenic
1026735189 7:72944799-72944821 AGGAGGTCATGGGGGTGGCAGGG + Intronic
1026785530 7:73299728-73299750 AGGAGGTCATGGGGGTGGCAGGG + Intergenic
1027108542 7:75420208-75420230 AGGAGGTCATGGGGGTGGCAGGG - Intronic
1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG + Intergenic
1028599464 7:92586458-92586480 CTAACATTAAGTGGGTGGCATGG + Intronic
1029035208 7:97512813-97512835 CTCAGGGTTTGTGGGTAGCAGGG + Intergenic
1029511344 7:100997331-100997353 CTGAGGTTGTGGGGGTGCGAGGG - Exonic
1029895859 7:103983193-103983215 TTGAGGATGTGTGTGTGGCAGGG - Intronic
1032442480 7:131952597-131952619 CTGAGGCGGTGTGGGTGACAGGG + Intergenic
1032677955 7:134149285-134149307 CTGATGTTTTCTGGGTAGCAGGG + Intronic
1036049017 8:5174857-5174879 CTGAGGTTCTGTGGGTCACCTGG - Intergenic
1039917027 8:41867618-41867640 CTGATGGTGTGTGTGTGGCATGG - Intronic
1041176244 8:55199940-55199962 CTGAGGTCAGGTAGCTGGCAAGG + Intronic
1042114064 8:65412473-65412495 CTGAGGGCATGAGGGTGTCAGGG - Intergenic
1042953040 8:74220615-74220637 CTGAGGGTATGTGTGTGGTGGGG + Intergenic
1043191942 8:77235910-77235932 ATGAGGTTATATAGATGGCAAGG - Intergenic
1044305820 8:90639373-90639395 CTGTGTGTATGTGGGTGGGAGGG - Intronic
1046658863 8:116926937-116926959 CTGAGGTTATATATATGGCAGGG - Intergenic
1047322366 8:123799254-123799276 CTGAGGTGATATGGCTGGAAGGG + Intronic
1049262429 8:141646769-141646791 CTGTGGGGAGGTGGGTGGCATGG - Intergenic
1049773447 8:144394187-144394209 CTGAGGCTCTGGGGGTGGCCGGG - Intronic
1051515158 9:17922539-17922561 CTGTGGTTATGTGGGTGAGGGGG - Intergenic
1054714820 9:68546843-68546865 GTGAGGCTTTGTGGGAGGCAGGG + Intergenic
1055828412 9:80354141-80354163 TTGAGGTAATGTGGATGGAATGG - Intergenic
1056067622 9:82953533-82953555 CTGTGGGTGGGTGGGTGGCAGGG - Intergenic
1056307253 9:85302319-85302341 ATGGGGTTATTTGGGGGGCAAGG - Intergenic
1057438723 9:95065757-95065779 CTGAGCTTCTGTGGGTTGCCAGG - Intronic
1059940466 9:119354400-119354422 CTGCTCTGATGTGGGTGGCAAGG + Intronic
1061017864 9:127992945-127992967 CTGAGGTTTTGTTGGTGGGGGGG + Intergenic
1061570320 9:131474061-131474083 CTGGGGCTATGGGGGTGGCAGGG - Intronic
1186180600 X:6969203-6969225 CGGAGTTCATGTGGGTAGCAAGG - Intergenic
1190262765 X:48808153-48808175 CAGATGTGATGGGGGTGGCATGG + Intronic
1196027324 X:111054789-111054811 CTGAGGTGATGGTGGAGGCAGGG - Intronic
1197733345 X:129830814-129830836 ATGAAGTTGTGTGTGTGGCAGGG - Intronic
1198438978 X:136643489-136643511 TTTAGGTTATGTGGGTGGAGAGG - Intergenic
1199743512 X:150757457-150757479 CTGAGGTCGTAAGGGTGGCAGGG - Intronic
1199872593 X:151912701-151912723 ATGGGGGTATGAGGGTGGCACGG - Intronic
1201771557 Y:17621421-17621443 CTGGGGTTGTGGGGGGGGCAGGG - Intergenic
1201829998 Y:18284565-18284587 CTGGGGTTGTGGGGGGGGCAGGG + Intergenic
1202085769 Y:21135199-21135221 CTGGGGATAAGTGGGTGACAGGG - Intergenic