ID: 904267933

View in Genome Browser
Species Human (GRCh38)
Location 1:29328508-29328530
Sequence GGTTGTTAGGGGATTGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904267933_904267943 22 Left 904267933 1:29328508-29328530 CCTTGCACAATCCCCTAACAACC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904267943 1:29328553-29328575 TACCTGCAGGATTGGTTGTGAGG 0: 1
1: 1
2: 0
3: 11
4: 170
904267933_904267940 9 Left 904267933 1:29328508-29328530 CCTTGCACAATCCCCTAACAACC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904267940 1:29328540-29328562 ACATAACAGGACCTACCTGCAGG 0: 1
1: 0
2: 0
3: 13
4: 130
904267933_904267945 28 Left 904267933 1:29328508-29328530 CCTTGCACAATCCCCTAACAACC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904267945 1:29328559-29328581 CAGGATTGGTTGTGAGGTCTAGG 0: 2
1: 0
2: 0
3: 7
4: 174
904267933_904267937 -4 Left 904267933 1:29328508-29328530 CCTTGCACAATCCCCTAACAACC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904267937 1:29328527-29328549 AACCCTGCAATAAACATAACAGG 0: 1
1: 0
2: 2
3: 10
4: 167
904267933_904267946 29 Left 904267933 1:29328508-29328530 CCTTGCACAATCCCCTAACAACC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904267946 1:29328560-29328582 AGGATTGGTTGTGAGGTCTAGGG 0: 2
1: 0
2: 0
3: 9
4: 139
904267933_904267941 14 Left 904267933 1:29328508-29328530 CCTTGCACAATCCCCTAACAACC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 904267941 1:29328545-29328567 ACAGGACCTACCTGCAGGATTGG 0: 1
1: 0
2: 1
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904267933 Original CRISPR GGTTGTTAGGGGATTGTGCA AGG (reversed) Intergenic
903455212 1:23483002-23483024 GGGTGATAGAGGATTGTGGAAGG - Intronic
904267933 1:29328508-29328530 GGTTGTTAGGGGATTGTGCAAGG - Intergenic
904917038 1:33977580-33977602 GGTTGGCAGGGGATTGGTCATGG - Intronic
905788068 1:40773847-40773869 GGATGTAAGGGGATCGTGCTGGG - Intergenic
906086729 1:43142444-43142466 AGATGTTAGGGGACAGTGCAGGG + Intergenic
908868153 1:68576032-68576054 GGCTGTTAGGAGATTGTGAGGGG - Intergenic
911255047 1:95623356-95623378 GGTTAATAGTGGATTGAGCAAGG - Intergenic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
916340437 1:163727710-163727732 GGTAGTTAGAGTTTTGTGCATGG + Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
918676610 1:187294288-187294310 GGTTGTCAGGGGTTTGGGAAAGG + Intergenic
920929752 1:210376345-210376367 GAATGTAAGGGGATTGTGAATGG - Intronic
1063741535 10:8827203-8827225 GGATTTTGGGGGATTGTGTAAGG - Intergenic
1069320273 10:67161010-67161032 GGGTGCTAGGGGATTGGGGAGGG + Intronic
1070903268 10:80049435-80049457 GGTTGGTAGGAGATTTTGAAAGG - Intergenic
1074979063 10:118604672-118604694 GGTTGACAGTGGATTGTGTAAGG - Intergenic
1075047726 10:119159394-119159416 GGTGGCCAGGGGTTTGTGCAGGG + Intronic
1075825278 10:125351520-125351542 GGGTCTTAGGGGATTGCACATGG - Intergenic
1075956003 10:126523739-126523761 GGTTGTTAGGGGCTGGGGGAAGG - Intronic
1078997451 11:16718188-16718210 GGTTATTGGGGGATTGAGGATGG - Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1082129248 11:48468303-48468325 GGTTGTGAGGGGCTAGAGCAGGG - Intergenic
1082562782 11:54639195-54639217 GGTTGTGAGGGGCTAGAGCAGGG - Intergenic
1084939292 11:72603779-72603801 AGTTGTTAGGGGAAGGTGAAAGG + Intronic
1086190599 11:84074425-84074447 GGTTGGTAGTGGCTTGGGCAAGG - Intronic
1088824527 11:113482697-113482719 GGTTGCTAGGAGATGGTTCAAGG + Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1089403054 11:118175923-118175945 GGGTATTAGGAGAGTGTGCAGGG - Intronic
1090398188 11:126432764-126432786 GGTTGTTATGGGCTTGAGCTGGG + Intronic
1091638669 12:2217235-2217257 GGTTGCCAGGGGCTGGTGCAGGG + Intronic
1092515445 12:9207040-9207062 GGTTGCCAGGAAATTGTGCAAGG + Intronic
1093260017 12:16924413-16924435 GGTTTTTGGGGGATTGTGGGGGG - Intergenic
1093773289 12:23042294-23042316 GGTTGTTAGGTGCTTGTGACAGG - Intergenic
1095280761 12:40350068-40350090 AGTTGTTCTGGGACTGTGCAGGG - Intronic
1097406042 12:59191514-59191536 GGTTGTTAGGTCTCTGTGCATGG + Intergenic
1108637973 13:52354837-52354859 GGTTGTCAGGGGTTTGGGAAGGG - Intergenic
1111882143 13:93970709-93970731 GGTTGTCAGGGCACTGAGCAAGG - Intronic
1111885425 13:94014699-94014721 GGTTGTCAGGGGATGGGGCAAGG - Intronic
1114616572 14:24071738-24071760 GGTGGTGAAGGGATTGGGCAGGG - Intronic
1122119694 14:99545598-99545620 GGTTGGTAGGGGAGTGTGATGGG - Intronic
1136563581 16:31056003-31056025 GGAGGGTAGGGGATTGTGGAGGG + Intergenic
1139206874 16:65037602-65037624 GGTTGTTAGGGGAGAGAGGAGGG - Intronic
1140432006 16:74912266-74912288 CGTTGTTTGGGTACTGTGCAGGG + Exonic
1142497261 17:312850-312872 GATTGTGAGGTGGTTGTGCACGG - Intronic
1145268272 17:21390971-21390993 GGCTGCCAGGGGATGGTGCAGGG - Intronic
1147816680 17:43215664-43215686 TGTTGTTGGGGTAGTGTGCAGGG + Intronic
1150370730 17:64635508-64635530 GGTTGCTAGGGGATGGGGGAGGG - Intronic
1153004936 18:489804-489826 GGTTGTTAGGGGAAGGTAAAAGG + Intronic
1155867908 18:30989432-30989454 GGTTGCCAGGGGATAATGCAGGG + Intergenic
1157703771 18:49783278-49783300 GGTTGTCAGGGGATGGGGGATGG + Exonic
1164877676 19:31703317-31703339 GCTTGCCAAGGGATTGTGCAGGG - Intergenic
1165149888 19:33754031-33754053 GGTTGTTGGGGGATGGTGGGGGG - Intronic
1166366678 19:42281483-42281505 GTTGGTTAGGGGTTGGTGCAGGG + Intronic
1167766509 19:51486454-51486476 GTTTCTTAGGGGATTTTCCAAGG + Intronic
1168353083 19:55687496-55687518 GGGGGTTAGGGGCATGTGCAAGG + Intronic
925964770 2:9053814-9053836 GGTTGGTAGGGGAATGAGCCGGG + Intergenic
928983468 2:37158242-37158264 GGTTGTTGGGGGATGGAGAAGGG - Intergenic
932274680 2:70443069-70443091 GGAGGTAAGGGGATTGAGCAGGG + Intergenic
937254767 2:120547452-120547474 GGCTGTTAGGGGCTGGAGCATGG - Intergenic
943654034 2:190488359-190488381 GGTTGTCAGGGGATGGGACAAGG + Intronic
945374278 2:209061125-209061147 GATTTTAAGGGGATGGTGCAGGG + Intergenic
946464685 2:219901777-219901799 AGTTGTTAGGGTATTTAGCAAGG - Intergenic
947454819 2:230244498-230244520 GGTTCTTAGGGGAGTGGGCCAGG + Intronic
1169656956 20:7935015-7935037 GGTTGTCAGGGGATTGAACTGGG - Intronic
1173373655 20:42462457-42462479 AGGTGTTGGGGGATTATGCAAGG + Intronic
1173861900 20:46289240-46289262 GGTTGTAAGGGAAAGGTGCATGG - Intronic
1175134568 20:56813322-56813344 TGTTGTTAGGGGGCTGTCCAGGG + Intergenic
1182843147 22:33408429-33408451 GGTCGTGAGGTGTTTGTGCAAGG + Intronic
1183761179 22:39819571-39819593 GGTTGTTAGGGGTTAGTGGGAGG + Intronic
1184729856 22:46366171-46366193 GGTTGTTGGGGGAAGGTGCAGGG + Intronic
950746913 3:15097998-15098020 GGTCGTTAGGGGTGAGTGCATGG - Intronic
954696409 3:52429606-52429628 GTTTATTAGGGGTGTGTGCAGGG - Intergenic
955677998 3:61469563-61469585 GGTTGCTAGGGGATGGGGAAGGG - Intergenic
955727813 3:61951663-61951685 TGTTTTTTGGGGAATGTGCAAGG + Intronic
955961223 3:64343217-64343239 GGTTGTTGGGGGAGCTTGCAGGG - Intronic
956219175 3:66883940-66883962 GGTTGCTATGAGATTGTGCATGG + Intergenic
958984101 3:100760532-100760554 GCTTGTTATGGGATTGAGCTAGG + Intronic
960153647 3:114275840-114275862 GGCTGTTGGGGGATGGTGAAGGG + Intergenic
960817719 3:121689821-121689843 GCTTGTTAGGGGATTCTACTTGG - Intronic
961308248 3:125974861-125974883 GGTTGGCAGGGCACTGTGCAAGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962158224 3:132971619-132971641 GGTTGCTAGGGGATGGGGGAGGG + Intergenic
963579075 3:147101140-147101162 GGTTGTTGGGGGAATGTGTTGGG - Intergenic
963824975 3:149943687-149943709 GGTTGCTAGGGGATGGGGGAAGG - Intronic
966398279 3:179523425-179523447 GGTTGTGGAGGGATTGTGGAGGG + Intergenic
967963199 3:194941539-194941561 TGTTGTTAGGGGGCTGTGCAGGG + Intergenic
968888550 4:3352738-3352760 GGTTGTTTGGCCTTTGTGCAAGG + Intronic
971765108 4:30820875-30820897 GGTTGTTATTGCATTTTGCATGG + Intronic
974563443 4:63553002-63553024 CTCTGTTAGGGGATTGTGGAAGG - Intergenic
976686820 4:87822955-87822977 GGTTGGTATGGAGTTGTGCAAGG + Intronic
977222456 4:94354208-94354230 GGTTCTTTGGAGATTGTCCATGG - Intergenic
981367695 4:143922463-143922485 GGTTGTCAGGGGCTTGGGGAGGG - Intergenic
981974908 4:150714849-150714871 GCTTGTTAGGTGAATGTGGATGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989663007 5:43819956-43819978 GGTTGTTAGGTCTTTGTGGAAGG + Intergenic
990735638 5:58858615-58858637 GGTAGTGAGGAGATTGTGCCAGG + Exonic
992408334 5:76480690-76480712 AGTTCCTAGGGGATTTTGCAGGG + Intronic
996206502 5:120744391-120744413 GGTTGGAAGGGGATTGGGGAAGG + Intergenic
996648525 5:125845413-125845435 GCTTGTCAGGGGTTTGGGCAAGG + Intergenic
998577430 5:143331957-143331979 GGTTTTTTGGGGAGTGGGCAGGG + Intronic
998589377 5:143461296-143461318 GGTGGTTAGGGGTTTGGGGAGGG - Intergenic
998899519 5:146838249-146838271 GGTGGTTAGGGGATTTCCCAAGG + Intronic
999350801 5:150869655-150869677 GCTTGTTATGGGTTTGTTCAGGG + Intronic
1001559909 5:172662232-172662254 GGTTGTTGGGGGCTGGGGCAGGG + Intronic
1003164030 6:3660740-3660762 GGAGGTTAGGGGAATGGGCATGG + Intergenic
1003487517 6:6592391-6592413 GGGTGTTTGTGGTTTGTGCATGG - Intronic
1010860909 6:80910031-80910053 GCTTATTATGTGATTGTGCAGGG - Intergenic
1015887655 6:137935165-137935187 GGTTGCCAGGGGATGGTGGAAGG - Intergenic
1018822430 6:167383617-167383639 GGGTGTGAGGGGAATGTGAATGG + Intronic
1021330415 7:19331574-19331596 GGTTGTTAGGGGCTAGTGGGAGG - Intergenic
1021865503 7:24952803-24952825 GGTTGATAGGGAATTGGGTAGGG - Intronic
1022762126 7:33366052-33366074 GGGGGTTAGGGGAATGTGCAAGG + Intronic
1023776825 7:43615932-43615954 GGTTGCTTGGGGTGTGTGCATGG - Intronic
1023857156 7:44191316-44191338 GGTGGTTTGGGTATGGTGCAAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1029418864 7:100461618-100461640 GGTTGTTAGGGGAAGGTGGAGGG - Intronic
1030179840 7:106694840-106694862 TATTGATGGGGGATTGTGCATGG - Intergenic
1031414585 7:121480275-121480297 GGATGAAAGGGGAATGTGCAAGG - Intergenic
1033186346 7:139230889-139230911 GGTTGTTAGCTGATTATTCAAGG - Intronic
1033289941 7:140075338-140075360 GGCTGGCAGGGGAGTGTGCATGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034553994 7:151838332-151838354 GGTGCTGAGGGGATTGAGCAAGG - Intronic
1035043182 7:155945771-155945793 GGTTGTTAGGGGTGTGAGAACGG + Intergenic
1038178539 8:25204290-25204312 GGTTTTTGGGGGATAGTGCATGG + Intronic
1038190912 8:25319489-25319511 GGGGGTGAGGGGCTTGTGCATGG + Intronic
1039477192 8:37845381-37845403 GCTTGTTAGGGGAAGGTGGAGGG + Intronic
1040886646 8:52270711-52270733 GGTTGTTTGGGGGTGGTGCAGGG + Intronic
1041828736 8:62128401-62128423 TGTTGTTAGGGGATACTGTAGGG - Intergenic
1050200028 9:3134940-3134962 GGTTGTTAGGGGTTAGGGGAAGG + Intergenic
1056351790 9:85756940-85756962 GGTTGGTGGGGGATTGGGCGGGG + Intergenic
1056588653 9:87946624-87946646 GGTTGCTAGGGGATAGGGGAGGG - Intergenic
1057205125 9:93167290-93167312 GGTTGTAAGGAAATTGTGAAAGG - Intergenic
1059627398 9:116081664-116081686 GGTTGTCTGTGGATTGTGGAAGG + Intergenic
1059652358 9:116326742-116326764 GGTTGCTAGGGGATGGGGAAGGG - Intronic
1059730577 9:117053159-117053181 TGTAGGTAGTGGATTGTGCATGG + Intronic
1062390915 9:136333520-136333542 GGGTGCTTGGGGGTTGTGCAGGG + Intronic
1062522185 9:136962696-136962718 GTTTGTGGGGGGCTTGTGCAGGG + Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186484249 X:9921622-9921644 GGTTGTTAGGGGATGGGGGAAGG - Intronic
1190851562 X:54248813-54248835 GGAAATTAGGGGATTGTACAGGG + Exonic
1192925202 X:75748544-75748566 GGTGGGTAGGGGACAGTGCAGGG - Intergenic
1193882271 X:86937377-86937399 GGTTGTTACTGGCTTGTGCAGGG + Intergenic
1199239780 X:145532892-145532914 TGTTGCTAGGGGATGGTGTACGG - Intergenic