ID: 904268332

View in Genome Browser
Species Human (GRCh38)
Location 1:29331045-29331067
Sequence CAGTGGAGATGAGCCCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 306}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904268332_904268335 4 Left 904268332 1:29331045-29331067 CCTAGCTGGGCTCATCTCCACTG 0: 1
1: 0
2: 2
3: 25
4: 306
Right 904268335 1:29331072-29331094 TCACCATCAACAGCCTCTCCAGG No data
904268332_904268339 15 Left 904268332 1:29331045-29331067 CCTAGCTGGGCTCATCTCCACTG 0: 1
1: 0
2: 2
3: 25
4: 306
Right 904268339 1:29331083-29331105 AGCCTCTCCAGGTCCAGGGCCGG 0: 1
1: 1
2: 8
3: 53
4: 361
904268332_904268337 10 Left 904268332 1:29331045-29331067 CCTAGCTGGGCTCATCTCCACTG 0: 1
1: 0
2: 2
3: 25
4: 306
Right 904268337 1:29331078-29331100 TCAACAGCCTCTCCAGGTCCAGG 0: 1
1: 1
2: 3
3: 27
4: 288
904268332_904268338 11 Left 904268332 1:29331045-29331067 CCTAGCTGGGCTCATCTCCACTG 0: 1
1: 0
2: 2
3: 25
4: 306
Right 904268338 1:29331079-29331101 CAACAGCCTCTCCAGGTCCAGGG 0: 1
1: 1
2: 1
3: 26
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904268332 Original CRISPR CAGTGGAGATGAGCCCAGCT AGG (reversed) Intergenic
900111521 1:1008081-1008103 CACTGGAGAACAGCCAAGCTGGG - Intergenic
900458195 1:2787429-2787451 AGGTGGAAATGGGCCCAGCTGGG - Intronic
900560398 1:3302812-3302834 GGGTGGAGAAGACCCCAGCTGGG + Intronic
901250206 1:7771825-7771847 CAGTGCAGATGCCCCTAGCTAGG - Intronic
901775405 1:11557153-11557175 GAGTGGAGAAGAGCCCAGGGAGG - Intergenic
902145861 1:14398562-14398584 CAGTGGACCTGATCCCACCTGGG - Intergenic
902914276 1:19626915-19626937 CAGCGGAGATGTGCCCTGCCAGG - Exonic
903340695 1:22652608-22652630 CAGAAGAGATGAGCCCAGAAAGG + Intergenic
904268332 1:29331045-29331067 CAGTGGAGATGAGCCCAGCTAGG - Intergenic
905289757 1:36913185-36913207 GTTTGGAGATGAGCCCAGTTGGG - Intronic
905410108 1:37762797-37762819 CAGTGCAGTCCAGCCCAGCTCGG + Exonic
907013292 1:50985820-50985842 CCCAGGAGTTGAGCCCAGCTGGG - Intergenic
907023089 1:51087466-51087488 CAGTGGTGATGAGGGCTGCTGGG + Intergenic
907461750 1:54609391-54609413 CAGTGGAGCACAACCCAGCTGGG - Exonic
908968636 1:69797671-69797693 TAATGGAGATGAGACCAGTTAGG - Intronic
909197733 1:72648682-72648704 GAGGGGAGTTGAGGCCAGCTTGG + Intergenic
910914428 1:92274108-92274130 AAGTAGAGGTGAGACCAGCTTGG - Intronic
911010795 1:93278968-93278990 CAATGGAGAAGAACCAAGCTGGG - Intergenic
913371427 1:118103913-118103935 GAAAGGAGATGAGCCCAGCAGGG + Intronic
915016140 1:152735914-152735936 CTGTGGAAATGAGACCAGGTTGG - Intergenic
915064669 1:153215018-153215040 GAGGGGAGGTGAGCCCAGTTAGG - Intergenic
920422310 1:205843410-205843432 CATTTGAGATGACCCCAGCCTGG + Intronic
920422396 1:205844019-205844041 CATTTGAGATGACCCCAGCCTGG - Intronic
921186559 1:212675163-212675185 CAGTGGAGCTGCTCCCAGCTTGG + Intergenic
921315695 1:213888257-213888279 AAGGGAAGATGAGCCCAGGTGGG - Intergenic
922776558 1:228216765-228216787 CAGTGGAGGCGAGCCCAGCTTGG + Intronic
923958714 1:239052755-239052777 CATTGGAGAAGAACCAAGCTGGG - Intergenic
924851847 1:247838885-247838907 GAGTGGAGAGTAGTCCAGCTAGG - Intergenic
1064573575 10:16721325-16721347 CAGGGGAGATGAGTCCAGAGAGG + Intronic
1064883230 10:20080839-20080861 CAGAGGAGATCCGCCCATCTGGG + Intronic
1069749011 10:70733918-70733940 CTGTGCAGATGAGACCAGCCTGG + Exonic
1070310399 10:75269396-75269418 CATTGGAGAAGAACCAAGCTAGG - Intergenic
1070845486 10:79519599-79519621 CAGTGGAGGTGAGTACAGCCTGG + Intergenic
1070928307 10:80240715-80240737 CAGTGGAGGTGAGTACAGCCTGG - Intergenic
1071080555 10:81805062-81805084 AAGTCCAGATGAGTCCAGCTCGG - Intergenic
1071081159 10:81813063-81813085 CTGAGGAGTTGAGCCCAGCCTGG + Intergenic
1072298134 10:94032197-94032219 CAGTGGAGATAAGGCAAGATGGG + Exonic
1072827074 10:98618119-98618141 CAGTGGAGTTGAGACCAAATGGG + Intronic
1073945121 10:108741188-108741210 CAGCAGAGATGAGCAAAGCTGGG - Intergenic
1074720136 10:116257065-116257087 CAGTGGGGATGTGCACAGCATGG - Intronic
1074848651 10:117421048-117421070 CAGGTGAGATCAGCCCAGCTGGG - Intergenic
1076108873 10:127846029-127846051 CAGTGGGGAAGAGCTCAGTTTGG - Intergenic
1076731534 10:132441391-132441413 GGGTGGAGATGAGCTCAGCCCGG - Intergenic
1076867851 10:133176897-133176919 CAGTCAAGCTGAGCACAGCTCGG + Intronic
1077032777 11:477161-477183 GAGTGGAAATGGGCCCAGCCCGG + Intronic
1077295511 11:1824627-1824649 CAGGGAAGATGAGTCCTGCTGGG + Intergenic
1078195187 11:9131255-9131277 CAGGGGAGATGAGCACAGCTTGG - Intronic
1078712546 11:13808645-13808667 TAGTGGAGTTGAGGCCATCTGGG + Intergenic
1079290607 11:19184751-19184773 CAGTGGAGAGGACCAGAGCTGGG + Intronic
1082786908 11:57322367-57322389 CAGTGGGGCGGAGCCCAGGTTGG - Intronic
1083555767 11:63625770-63625792 CAGAGGAGTTGAGACCAGCCTGG + Exonic
1083924760 11:65799148-65799170 CAGGGGAGATGAGCGAAGCCAGG + Intergenic
1084009621 11:66340295-66340317 CAGGGGAGATGAGGCCAGGCCGG - Intronic
1084044786 11:66562289-66562311 CCATGGAGATGAGGCAAGCTCGG - Exonic
1084261579 11:67982299-67982321 CGGTGGCGATCAGCCCAGGTGGG + Intergenic
1084360747 11:68667251-68667273 CAGTGGAGATGAGGGGCGCTGGG + Intergenic
1084360778 11:68667395-68667417 CAGTGGAGATGAGGGGCGCTGGG + Intergenic
1084811063 11:71611812-71611834 CGGTGGCGATCAGCCCAGGTGGG - Intergenic
1085042403 11:73334405-73334427 CAGTGGTGAAGAGACCAGCCTGG + Intronic
1086177087 11:83903846-83903868 CAGTGGAAATGTGCCAAGATTGG + Intronic
1087970007 11:104468970-104468992 CAGTAGAAATGAGATCAGCTAGG + Intergenic
1088482580 11:110308895-110308917 AAGTCGACATGAGACCAGCTAGG - Intergenic
1091935478 12:4431358-4431380 CAGTGGACATGTGACCAGATAGG + Intronic
1092342771 12:7690590-7690612 CAGTTGACATTGGCCCAGCTGGG - Exonic
1093974766 12:25409297-25409319 CAATGGAGAAGAACCAAGCTGGG - Intronic
1095818466 12:46450624-46450646 CACTGGAAGTGAGCCAAGCTGGG + Intergenic
1096450210 12:51734191-51734213 CAGTGCTGCTGAGACCAGCTCGG + Intronic
1096866844 12:54569480-54569502 GAGTGGAGGTGTGGCCAGCTGGG - Intronic
1097038049 12:56137086-56137108 CTGTAGAGATGAGCCCAGCCAGG + Intronic
1101415783 12:104507023-104507045 CAGAGGGGAAGAGCACAGCTGGG + Intronic
1101560776 12:105855679-105855701 CAGTGGCGATGAGGGCAGCCAGG + Intergenic
1102147662 12:110667033-110667055 CGGCCGAGATGAGCCCAGCATGG - Intronic
1103461221 12:121106742-121106764 CACTGGTTGTGAGCCCAGCTCGG - Intergenic
1105696829 13:22897594-22897616 CACTGGGGAGGAGCCCAGCAAGG - Intergenic
1106101772 13:26699375-26699397 CAGTGGCTAAGACCCCAGCTGGG - Intergenic
1108535225 13:51370014-51370036 CAGTAGAGATGAATTCAGCTGGG - Intronic
1108692240 13:52870020-52870042 CAGAGAAGATGAGCTCTGCTGGG - Intergenic
1109630760 13:65043089-65043111 CAGTGGAGAATAGCCCATGTTGG + Intergenic
1113111496 13:106828703-106828725 CAGTGGAGATGAGCTATGCCAGG - Intergenic
1113636088 13:111920070-111920092 CCATGGAGCTGGGCCCAGCTGGG + Intergenic
1115137327 14:30126853-30126875 TCCTGGAGATGAGCCCAGTTAGG - Intronic
1115268042 14:31521965-31521987 CACTGGAGCAGAGCCCATCTAGG + Intronic
1115768352 14:36646766-36646788 GAGTGGAGATGACCGCAGCCAGG + Intergenic
1117038325 14:51748818-51748840 CGGTGGCGATCAGCCCAGGTGGG - Intergenic
1117468707 14:56020318-56020340 CAGTGTAGATGTGCCCAGGTTGG - Intergenic
1117834379 14:59787202-59787224 CTGTGGAGCTGAGCCCCCCTAGG + Intronic
1118608636 14:67522356-67522378 CAGAGGAGAGGTGACCAGCTTGG - Intronic
1118785923 14:69045213-69045235 CCGTGGAGATGTCCCAAGCTTGG - Intergenic
1118787676 14:69059617-69059639 CAATTGAGATGAGGCCAGCATGG + Intronic
1119159167 14:72438869-72438891 CAGTGGAGAGGAGACCAGGAAGG - Intronic
1120338716 14:83191385-83191407 CAGTGGGGAGGAGCCCACTTTGG - Intergenic
1122424821 14:101599713-101599735 CAGTGGGGATGGCTCCAGCTGGG + Intergenic
1122781970 14:104147519-104147541 CTTTGGAGAGGTGCCCAGCTGGG + Intronic
1122867092 14:104611278-104611300 GAGTGGAGATGAGTCAAGCTCGG + Intergenic
1125600869 15:40915280-40915302 CAGTGGAGACGGCCCAAGCTGGG + Intergenic
1127808351 15:62541550-62541572 CAGTGGGGCTGACCCCAGGTAGG - Intronic
1127891484 15:63255609-63255631 CATTGGAGAAGAGTCCTGCTGGG + Intronic
1128109094 15:65065217-65065239 CAGTGAATATGACCCCAACTTGG - Exonic
1128261634 15:66236844-66236866 CAGAGGAGCTGAGCCAAGATGGG + Intronic
1129477734 15:75797408-75797430 CTCTGGTGATGAGCTCAGCTGGG - Intergenic
1129835802 15:78704674-78704696 CTCTGGTGATGAGCTCAGCTGGG - Intronic
1130511549 15:84593949-84593971 CTCTGGTGATGAGCTCAGCTGGG + Intergenic
1133983906 16:10653357-10653379 CAGTGGAGATGAGGCAAGACTGG + Intronic
1134324908 16:13198554-13198576 GATTGGAGATAAGCCCAGGTTGG - Intronic
1134858580 16:17540871-17540893 CACTGGAGATGAGCCAACCTGGG + Intergenic
1136349881 16:29699820-29699842 CTGGGGAAATGATCCCAGCTTGG - Intergenic
1136544238 16:30947017-30947039 CAGTGGAGCTGAGACCAGGCAGG - Intronic
1138374853 16:56556041-56556063 CAGGGGAGAGGAGCCCCGCGTGG - Intergenic
1138857481 16:60712028-60712050 CAGTGTGGATGAGCCCAGGGTGG + Intergenic
1140872949 16:79123405-79123427 GAGTGGAAATGAGGGCAGCTGGG + Intronic
1141750292 16:85953782-85953804 GTGTTGAGCTGAGCCCAGCTGGG + Intergenic
1142742635 17:1940061-1940083 CAGTGGCGGTGAGGCCTGCTGGG - Intronic
1143091676 17:4452704-4452726 CAATGGAGATGAGGCAGGCTGGG + Intronic
1143747067 17:9002892-9002914 CAGTGGAGCTGGGCCAAGATAGG - Intergenic
1144452329 17:15391367-15391389 CACTGGAGTTCAGGCCAGCTGGG - Intergenic
1145274679 17:21422444-21422466 CAGGGGAGAGCAGCCCAGCCTGG + Intergenic
1145312530 17:21708342-21708364 CAGGGGAGAGCAGCCCAGCCTGG + Intergenic
1146770718 17:35566643-35566665 CATTGGAGAAGAACCAAGCTGGG + Intergenic
1147546259 17:41404261-41404283 CAAAGGAGATGAGGGCAGCTGGG + Intergenic
1148564114 17:48623229-48623251 CACTGGAGAAGAGGCCACCTGGG + Intronic
1148735059 17:49860611-49860633 CAGTGGTGATGAGCTCAGACTGG - Intergenic
1150412004 17:64953027-64953049 CACTGCATATGTGCCCAGCTAGG - Intergenic
1150710780 17:67529229-67529251 CACTCGAGCTGAGCCCAGCCAGG + Intronic
1151194682 17:72423153-72423175 CAGTGCAGATGAGCTCACCCGGG - Intergenic
1151250732 17:72832415-72832437 CAGAGGCGATGAGCTCAGCATGG - Intronic
1151328189 17:73391585-73391607 AGCTGGGGATGAGCCCAGCTCGG + Intronic
1151519955 17:74620831-74620853 CACTGGAGGTGAGACCAGCCTGG + Intronic
1151560130 17:74865607-74865629 CAGAGGCACTGAGCCCAGCTTGG + Intronic
1152382022 17:79947069-79947091 TGGTGGGGCTGAGCCCAGCTGGG - Intronic
1152423705 17:80207787-80207809 CAGTGGAGCTGAGGCCGGGTGGG - Intronic
1152569862 17:81116931-81116953 CAGGAGAGTTGAGCACAGCTGGG - Exonic
1153758030 18:8302850-8302872 CTGTGGAGAGGAGCTCAGGTTGG + Intronic
1153954374 18:10083606-10083628 CAGTGTAGCTGAGCCCTGATTGG + Intergenic
1157466938 18:47955514-47955536 CAGTGGAGATGTGGACACCTGGG - Intergenic
1157546556 18:48550572-48550594 GAGTGGAGAGGAGCCCAGAGGGG - Intronic
1158120079 18:54039215-54039237 CAGTGGAGCTGGTTCCAGCTAGG - Intergenic
1160096180 18:75875731-75875753 CAGTGGAGAGGAGCCCCGTGTGG + Intergenic
1162405309 19:10469490-10469512 CTGGGGAGAGGAGCCCTGCTTGG - Exonic
1162886351 19:13700287-13700309 CATTGCAGCTCAGCCCAGCTGGG - Intergenic
1163607863 19:18285350-18285372 CACTGGAGAAGAACCAAGCTGGG - Intergenic
1163676846 19:18659733-18659755 CCATGGAGATGAGGCCAGCCCGG + Intronic
1163710881 19:18846117-18846139 CAGGTGAGCTGAGCTCAGCTGGG + Exonic
1164588979 19:29495792-29495814 AAGTGTAGATGAGCTCAGGTGGG + Intergenic
1164704331 19:30308863-30308885 CTTTGGTGATGAGGCCAGCTTGG + Intronic
1164777159 19:30861952-30861974 CATTAGTGATTAGCCCAGCTTGG + Intergenic
1165824314 19:38697130-38697152 CAGAGAAGATGAGCACAGGTGGG + Intronic
1166907297 19:46120181-46120203 CTTTGGAGAGGAGCCCAGCTGGG - Exonic
1167893770 19:52564202-52564224 CATTGGAGAAGAACCAAGCTGGG + Intronic
1167993841 19:53386359-53386381 CATTGGAGAAGAACCAAGCTGGG + Intronic
1168203108 19:54831065-54831087 CCGTGGAGATGAGACTAGCAAGG - Intronic
926221076 2:10935756-10935778 CAGTGAGGATGAGTCCAGCACGG - Intergenic
926273510 2:11386071-11386093 AAGTGGAGATGAGGTCATCTTGG + Intergenic
927703454 2:25282565-25282587 CAGAGGAGGGGAGCCCTGCTGGG - Exonic
927839721 2:26432204-26432226 CAGTGGAGGTGAGCTGAGCACGG + Intronic
927897029 2:26789446-26789468 CGGAGGAGATGAGACCACCTAGG - Intronic
927961299 2:27242116-27242138 CAGTGGAGGTGAGGCCAGCCTGG + Exonic
928396373 2:30945898-30945920 TTATGGAGAGGAGCCCAGCTGGG + Intronic
928910372 2:36415019-36415041 CACTGAAGAAGAGCCCAGCCAGG + Intronic
930013756 2:46957021-46957043 CAGTGGAGGGGAGCCCAGGCTGG - Intronic
930382836 2:50653840-50653862 CAGAGAAGATGATCACAGCTAGG - Intronic
931496270 2:62810539-62810561 GAGTGGAGATGAGTTCAGTTTGG + Intronic
931745579 2:65289081-65289103 CTGTGGTGATGCGCCCACCTTGG + Intergenic
932252145 2:70253862-70253884 CATTGGAGAAGAACCAAGCTGGG - Intergenic
933039292 2:77441956-77441978 CAGAGGAGATGTCACCAGCTTGG + Intronic
934334186 2:92108812-92108834 AAGTGGATATTAGGCCAGCTTGG + Intergenic
934384644 2:92962120-92962142 AAGTGGATATTAGGCCAGCTTGG + Intergenic
934424325 2:93601390-93601412 AAGTGGATATTAGGCCAGCTTGG + Intergenic
939017680 2:136920761-136920783 CAGGGGAGCTGAGGGCAGCTTGG - Intronic
940154798 2:150644282-150644304 CAGTGGAGAGAAGCCCAGAAAGG - Intergenic
940956928 2:159738594-159738616 CAGTGGAGAGGAGACCAGACAGG + Intronic
941360703 2:164547780-164547802 CAGTGAAGATGAAACCAGCAGGG - Exonic
944496463 2:200312005-200312027 CTGAGGAGTTGAACCCAGCTAGG + Intronic
944699301 2:202231823-202231845 CATTGGAGAAGAACCAAGCTGGG + Intronic
945379051 2:209117358-209117380 CAGATGAAATGAGCCCAGCTGGG + Intergenic
946435807 2:219652173-219652195 CAGTGGTGCCGAGACCAGCTGGG - Intergenic
947704524 2:232263493-232263515 CAGCGTGGATGAGCGCAGCTTGG + Intronic
948398216 2:237663143-237663165 AAGTGGAGCTTAGCCCATCTGGG - Intronic
1168884761 20:1241026-1241048 GAGTGGAGCTTAGCCCATCTGGG - Intronic
1168974025 20:1950788-1950810 CAATGGGAATGAGCCCAGCCTGG - Intergenic
1169219437 20:3813098-3813120 CACAGGAGAAAAGCCCAGCTTGG + Intergenic
1170442960 20:16397240-16397262 CATTGGAGAGGTGCCCAGCCAGG - Intronic
1170566681 20:17611711-17611733 CAGAGGGGATCAGCCCAGCATGG + Intergenic
1170792390 20:19518806-19518828 CAGTTGAGAAGAGCCCAGGCAGG + Intronic
1170890792 20:20373622-20373644 CTGTGGAGTTCAGCCCAACTGGG - Intergenic
1170931287 20:20771408-20771430 CACTGGAGCTGAGCCCATCCAGG + Intergenic
1171614686 20:26957209-26957231 AAGTGGGTATGAGGCCAGCTTGG + Intergenic
1171620961 20:27051382-27051404 AAGTGGATATTAGGCCAGCTTGG + Intergenic
1171639150 20:27323980-27324002 AAGTGGGTATGAGGCCAGCTTGG + Intergenic
1171819730 20:29823720-29823742 CACTGGCTCTGAGCCCAGCTCGG + Intergenic
1173009514 20:39169062-39169084 CAGTGTAGAGGAGCACAGCAAGG - Intergenic
1175374229 20:58513929-58513951 CAGTTGAAGTGTGCCCAGCTGGG - Intronic
1175591086 20:60192831-60192853 CAGTGGTGAGGAGCAGAGCTGGG + Intergenic
1175621815 20:60453935-60453957 AAGTGGAGAGGAGGACAGCTGGG - Intergenic
1179805255 21:43833140-43833162 CAGTGGAGATGACCCCTTCCCGG + Intergenic
1180185569 21:46137529-46137551 CTGTGGGGCTGAGCCCTGCTTGG - Intronic
1180323732 22:11348411-11348433 CACTGGCTCTGAGCCCAGCTCGG + Intergenic
1180783872 22:18536263-18536285 CAGTGGGGATGAACCCAGGTTGG + Intergenic
1181127440 22:20710312-20710334 CAGTGGGGATGAACCCAGGTTGG + Intronic
1181167907 22:20993152-20993174 CTCTGGTGCTGAGCCCAGCTTGG - Intronic
1181240772 22:21475615-21475637 CAGTGGGGATGAACCCAGGTTGG + Intergenic
1181485046 22:23225329-23225351 CAGTGAAAATGAGCCCAGATGGG - Intronic
1181600682 22:23949991-23950013 CAGTGGAGCTGACCAAAGCTGGG + Intergenic
1181607830 22:23991331-23991353 CAGTGGAGCTGACCAAAGCTGGG - Intergenic
1184104039 22:42357187-42357209 CAGCGGCGATGAGCGGAGCTAGG - Intergenic
1184326615 22:43792403-43792425 AAGTGGAGATGTGCACATCTTGG + Intronic
1184798801 22:46747811-46747833 CACCTGAGATGAGCCCAGCAAGG - Intergenic
1184887826 22:47357179-47357201 CAGGGGAGCAGAGCCCAGCCTGG - Intergenic
1185232204 22:49689725-49689747 GAGTTGAGATCAGCCCAGCTCGG + Intergenic
1202716022 2_KI270715v1_random:3167-3189 AAGTGGATATTAGGCCAGCTTGG + Intergenic
1202716729 2_KI270715v1_random:13387-13409 AAGTGGATATTAGGCCAGCTTGG + Intergenic
1202728715 2_KI270716v1_random:37126-37148 AAGTGGATATTAGGCCAGCTTGG + Intergenic
1202729044 2_KI270716v1_random:41895-41917 AAGTGGATATTAGGCCAGCTTGG + Intergenic
950114655 3:10443003-10443025 CAGTGGGGAAGAGGCCAACTTGG - Intronic
950448582 3:13052974-13052996 CATTGGAGAAGAACCAAGCTGGG - Intronic
951526596 3:23658838-23658860 CAGTGAAAATGAACCCAGCAAGG - Intergenic
953536874 3:43783302-43783324 CAGTGGAGATGGCACAAGCTAGG - Intergenic
953788670 3:45929939-45929961 CAGAGCAGGAGAGCCCAGCTAGG - Intronic
954294283 3:49665525-49665547 CCTTGGAGAAGAGCCCAGCACGG + Intronic
954370536 3:50167619-50167641 CAGGGGTAAAGAGCCCAGCTGGG - Intronic
955067732 3:55547213-55547235 CAGTGGTGGTGGGCCCGGCTGGG - Intronic
957076652 3:75607872-75607894 CGGTGGCGATCAGCCCAGGTGGG + Intergenic
957087205 3:75692235-75692257 CACTGGCTCTGAGCCCAGCTAGG - Intergenic
962236478 3:133711617-133711639 CAGGGGAAATGAGGGCAGCTGGG - Intergenic
962851732 3:139313216-139313238 CAGTGCAGAGCAGCCAAGCTTGG - Intronic
964804009 3:160587284-160587306 CACTGGCTCTGAGCCCAGCTTGG - Intergenic
966347590 3:178996708-178996730 CACTGCAGAAGAGCACAGCTGGG + Intergenic
967204648 3:187108423-187108445 CAATGGATATGAGCTCACCTTGG - Intergenic
967205904 3:187121152-187121174 CATTGGAGAAGAACCAAGCTGGG - Exonic
967556435 3:190863944-190863966 CAGTGGACATAAGCCAAGGTGGG - Intronic
967930684 3:194688071-194688093 CAGTGCAGACGAGCCCCACTCGG + Exonic
967939856 3:194757277-194757299 CAGTGGAGCACAGCCCAGCTGGG + Intergenic
968167940 3:196483446-196483468 CAGTGAAGATAAGCCTATCTGGG + Intronic
968348309 3:198030495-198030517 GAAAGGAGATGAGCCCAACTGGG - Intronic
968895755 4:3402064-3402086 CAGTGGACATGGGACCAGCATGG + Intronic
968960878 4:3743054-3743076 CAGTGGAGTGGAGCCAGGCTTGG - Intergenic
969020107 4:4134166-4134188 CGGTGGCGATCAGCCCAGGTGGG + Intergenic
969092212 4:4703118-4703140 CACTGGAGATGAGCCCCGAGGGG + Intergenic
974651249 4:64756086-64756108 CAGTGGAGGTGAGGCCTGGTGGG + Intergenic
978811940 4:112859443-112859465 GAGAGGAGCTGAGCCCAGTTAGG + Intronic
978875502 4:113636162-113636184 CAGTGGAGGTGGACACAGCTGGG - Intronic
979637876 4:122978067-122978089 CAGTGGAGAGGAGACCAGAATGG + Intronic
980496548 4:133592325-133592347 CTTTGGAGAGGAGGCCAGCTGGG + Intergenic
980499200 4:133626995-133627017 CAGTAGAGATGTGCCCAGTGAGG - Intergenic
982057922 4:151571621-151571643 GAGTGGAGATGAGCAGAGCAAGG - Intronic
984726318 4:183025133-183025155 CAGAGCAGATGAACCCAGGTTGG - Intergenic
987374246 5:17218642-17218664 CAGCGGGGCTGAGCCCAGTTAGG - Intronic
988244715 5:28665096-28665118 CAGTCCAGATGATGCCAGCTGGG - Intergenic
990339501 5:54808524-54808546 CAGTGGTGAAGAGCCCAGTGTGG - Intergenic
992803647 5:80315797-80315819 CACTGGAGAAGAACCAAGCTGGG + Intergenic
994992306 5:107012575-107012597 TAGTGGAGGAGAGCCCAGCCTGG - Intergenic
995718559 5:115105095-115105117 CAGAGTAGCTGAGCCCAGCAAGG + Intergenic
996315017 5:122152074-122152096 CACTAGAGAGAAGCCCAGCTTGG - Exonic
1002000067 5:176192364-176192386 CAGAGGAGCTGGGGCCAGCTCGG - Intergenic
1002480539 5:179498055-179498077 CAGTGGAGCCGAGCCCAGAGAGG - Intergenic
1002969333 6:1997697-1997719 CAGTGGAGATGAACCTCACTAGG - Intronic
1003098035 6:3157389-3157411 CCGTGGCGGTGAGCCCACCTTGG + Exonic
1004954698 6:20716466-20716488 CAGTGGAGATGAGAAGGGCTTGG + Intronic
1006610152 6:35289772-35289794 CTGTGGAGATGAGCTCACCTAGG - Intronic
1006856383 6:37136372-37136394 CAATGGAGTTGAGTCCAGCAAGG + Intergenic
1007657114 6:43456986-43457008 CAGCTGAGAGGAGGCCAGCTAGG - Intergenic
1007996714 6:46315577-46315599 CAGAGGAGATGAGGTCAGCAGGG + Intronic
1008044525 6:46838082-46838104 TAGTAGAGATGAGACCATCTTGG + Intronic
1008439437 6:51515843-51515865 CATTGGAGATGAGGCCAGTGTGG - Intergenic
1009643362 6:66365652-66365674 CATAGGAGATGATCTCAGCTTGG + Intergenic
1010212486 6:73373115-73373137 CATTGGAGAAGAACCAAGCTGGG - Intronic
1012185642 6:96212281-96212303 CAGAGGATATGAGCTCATCTAGG + Exonic
1013583923 6:111561844-111561866 AAGTGGAGATGAGACCAGTAAGG + Intronic
1014801072 6:125778477-125778499 CAGTGGAGATGAGGGCAGATAGG - Intergenic
1015861625 6:137687130-137687152 CAAAGGAGATGAGCCCAGCATGG + Intergenic
1016011803 6:139144597-139144619 CAGTGGAGAACCGCCCACCTAGG + Intronic
1018632416 6:165832661-165832683 CGGTGTGGATGAGCCCAGCTAGG + Intronic
1018861920 6:167717190-167717212 TGGAGGAGATGAGCCCAGGTGGG - Intergenic
1019418642 7:938719-938741 CAGGCAACATGAGCCCAGCTGGG + Intronic
1019528015 7:1489491-1489513 GACTTGGGATGAGCCCAGCTGGG - Intronic
1019938524 7:4271606-4271628 ACGTGGACAGGAGCCCAGCTTGG - Intergenic
1021588830 7:22239148-22239170 CTATGGAGATGTGCCCAGGTGGG + Intronic
1022533561 7:31081835-31081857 CAGAGGAGCAGAGCCCAGCCTGG - Intronic
1024019332 7:45351133-45351155 CATTGGAGATGACTCCAACTTGG - Intergenic
1024586119 7:50843585-50843607 CATTGGAGAAGAACCAAGCTGGG - Intergenic
1025238234 7:57249539-57249561 CAGTGGATCTGAGCAGAGCTGGG + Intergenic
1025744567 7:64231580-64231602 CAGTGGGGCTTGGCCCAGCTGGG + Intronic
1026334735 7:69383932-69383954 CAGTGGAGAGGAGGCTGGCTTGG - Intergenic
1028717420 7:93987480-93987502 CAGTGAAGATGATGCCAGCTTGG - Intronic
1028845127 7:95471728-95471750 CAGTGGAGTTGACTGCAGCTGGG + Intergenic
1029078635 7:97955140-97955162 CGGTGGCGATCAGCCCAGGTGGG + Intergenic
1029415893 7:100443043-100443065 CAATGGAGCTGAGCACAGCAAGG + Intergenic
1031162582 7:118185453-118185475 CACTTGAGGTGAGACCAGCTTGG - Intronic
1031164652 7:118214117-118214139 CCGTGGAGCTGAGCCCAGGACGG - Intergenic
1032261114 7:130337867-130337889 CAGTTGAGAGGAGGCCAGCTGGG + Intergenic
1032510345 7:132467188-132467210 CTGTGGAGATGACCCCAGAGAGG - Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1036491226 8:9227398-9227420 GAGGGGACATGAACCCAGCTGGG - Intergenic
1036703568 8:11030174-11030196 AGGTGGAAATGAGCCCAACTCGG - Intronic
1037450077 8:19008050-19008072 CAGCGGAGTTGAGACCAGCCTGG - Intronic
1038134045 8:24766687-24766709 AAGGGGAGGGGAGCCCAGCTGGG + Intergenic
1038427297 8:27472090-27472112 GAGGGGTGATGAGCCCAGCGAGG + Intronic
1039064944 8:33599595-33599617 CTGGGGAGAGGCGCCCAGCTAGG - Intronic
1040361737 8:46671564-46671586 CAGTGGAAAGGAGACCAGCTTGG + Intergenic
1040903956 8:52445630-52445652 CATTGGAGAAGAACCAAGCTGGG + Intronic
1041056989 8:53996326-53996348 CAGTGGTGAATAGCCAAGCTGGG - Intronic
1041118910 8:54566710-54566732 CAGTGGCGCTGAGCTCAGCTGGG - Intergenic
1047176801 8:122549324-122549346 TACTGGAGATGAGTCCAACTAGG - Intergenic
1047570323 8:126090920-126090942 CAGTCTAGCTGAGCCCAGCCTGG + Intergenic
1047956797 8:129982828-129982850 AAGAGGTGGTGAGCCCAGCTGGG - Intronic
1048615480 8:136070043-136070065 CAGATGAGATAAGCACAGCTAGG - Intergenic
1048976948 8:139678458-139678480 GAGTGGAGACGGGCCGAGCTGGG - Intronic
1049299693 8:141862988-141863010 AAGGGGAGATCAGCCCAACTGGG - Intergenic
1049326077 8:142022249-142022271 CAGGGGTCATGAGCCCACCTGGG - Intergenic
1049647486 8:143742157-143742179 CAGTGGTGATGCGGACAGCTGGG - Intergenic
1052242661 9:26293163-26293185 CTGTGGAGATGAGCACAGCAGGG - Intergenic
1053750657 9:41251255-41251277 CACTGGCTCTGAGCCCAGCTCGG - Intergenic
1054256168 9:62815598-62815620 CACTGGCTCTGAGCCCAGCTTGG - Intergenic
1054335136 9:63800016-63800038 CACTGGCTCTGAGCCCAGCTCGG + Intergenic
1055510412 9:76990754-76990776 GAAGGGAGATGAGGCCAGCTGGG - Intergenic
1056030942 9:82552454-82552476 GAGTAGAGATGAGACCAGCAAGG - Intergenic
1056498923 9:87189026-87189048 CAGGTGAGAGGGGCCCAGCTCGG - Intergenic
1056880568 9:90388240-90388262 CAGTGCAGCTGAGACCTGCTGGG + Intergenic
1057145909 9:92759541-92759563 CAGCAGAGCAGAGCCCAGCTTGG + Intronic
1057169208 9:92950779-92950801 CAGTGCAGATGAGTCCACCCAGG + Intronic
1057855132 9:98595836-98595858 CAATGGAGATGAGCCAATCTGGG + Intronic
1058175916 9:101737237-101737259 GAGTGGAGATGGGCGCTGCTGGG - Intronic
1061505338 9:131028662-131028684 CAGTGGAGAGGCGCCCGGCCAGG + Intronic
1062033214 9:134371397-134371419 CCGTGGCTATGAGCCCAGGTGGG + Intronic
1062248390 9:135581968-135581990 CAGTGGAGATGAGTGAAGCGTGG + Intergenic
1185823433 X:3226460-3226482 AAGTGGACATAAGCCCAGGTGGG - Intergenic
1189053527 X:37672572-37672594 CAGTGCAGCTGAGCCCTGATTGG + Intronic
1189196097 X:39154114-39154136 CAGTGGAGATTAGCTCAGTGAGG + Intergenic
1189900241 X:45699117-45699139 CAGTGGAGAGGGGTCCAGATGGG - Intergenic
1190732499 X:53234762-53234784 CGGTGGAATGGAGCCCAGCTGGG + Exonic
1192043062 X:67643616-67643638 CAGTGAAGGTGGTCCCAGCTGGG + Intronic
1196832458 X:119786691-119786713 CATTGGAGAAGAACCAAGCTGGG - Exonic
1198972315 X:142296251-142296273 AAGTGGAGAACAGCCTAGCTTGG + Intergenic
1201066940 Y:10106098-10106120 CACTGGCTCTGAGCCCAGCTCGG - Intergenic
1201255983 Y:12108694-12108716 AAGTGGACATAAGCCCAGGTGGG + Intergenic