ID: 904270550

View in Genome Browser
Species Human (GRCh38)
Location 1:29347203-29347225
Sequence GAAAAATATTTTCTTGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904270550_904270554 30 Left 904270550 1:29347203-29347225 CCAAACTCAAGAAAATATTTTTC No data
Right 904270554 1:29347256-29347278 TGTCCTAATCTTGTTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904270550 Original CRISPR GAAAAATATTTTCTTGAGTT TGG (reversed) Intergenic
No off target data available for this crispr