ID: 904270553

View in Genome Browser
Species Human (GRCh38)
Location 1:29347232-29347254
Sequence TTATCATGTGTAGCATTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904270553_904270554 1 Left 904270553 1:29347232-29347254 CCTGTAAATGCTACACATGATAA No data
Right 904270554 1:29347256-29347278 TGTCCTAATCTTGTTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904270553 Original CRISPR TTATCATGTGTAGCATTTAC AGG (reversed) Intergenic
No off target data available for this crispr