ID: 904270554

View in Genome Browser
Species Human (GRCh38)
Location 1:29347256-29347278
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904270550_904270554 30 Left 904270550 1:29347203-29347225 CCAAACTCAAGAAAATATTTTTC No data
Right 904270554 1:29347256-29347278 TGTCCTAATCTTGTTCCTCTAGG No data
904270552_904270554 8 Left 904270552 1:29347225-29347247 CCTAGGACCTGTAAATGCTACAC No data
Right 904270554 1:29347256-29347278 TGTCCTAATCTTGTTCCTCTAGG No data
904270553_904270554 1 Left 904270553 1:29347232-29347254 CCTGTAAATGCTACACATGATAA No data
Right 904270554 1:29347256-29347278 TGTCCTAATCTTGTTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type