ID: 904270909

View in Genome Browser
Species Human (GRCh38)
Location 1:29349484-29349506
Sequence TCCATGTGGCCCCCAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904270909_904270916 6 Left 904270909 1:29349484-29349506 CCTGGGCTTGGGGGCCACATGGA No data
Right 904270916 1:29349513-29349535 GGACATCGCCCTTTTCCTCGGGG No data
904270909_904270923 30 Left 904270909 1:29349484-29349506 CCTGGGCTTGGGGGCCACATGGA No data
Right 904270923 1:29349537-29349559 GTTCACAGTCTATGGGCTGGTGG No data
904270909_904270915 5 Left 904270909 1:29349484-29349506 CCTGGGCTTGGGGGCCACATGGA No data
Right 904270915 1:29349512-29349534 TGGACATCGCCCTTTTCCTCGGG No data
904270909_904270914 4 Left 904270909 1:29349484-29349506 CCTGGGCTTGGGGGCCACATGGA No data
Right 904270914 1:29349511-29349533 TTGGACATCGCCCTTTTCCTCGG No data
904270909_904270921 23 Left 904270909 1:29349484-29349506 CCTGGGCTTGGGGGCCACATGGA No data
Right 904270921 1:29349530-29349552 TCGGGGAGTTCACAGTCTATGGG No data
904270909_904270922 27 Left 904270909 1:29349484-29349506 CCTGGGCTTGGGGGCCACATGGA No data
Right 904270922 1:29349534-29349556 GGAGTTCACAGTCTATGGGCTGG No data
904270909_904270920 22 Left 904270909 1:29349484-29349506 CCTGGGCTTGGGGGCCACATGGA No data
Right 904270920 1:29349529-29349551 CTCGGGGAGTTCACAGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904270909 Original CRISPR TCCATGTGGCCCCCAAGCCC AGG (reversed) Intergenic
No off target data available for this crispr