ID: 904271126

View in Genome Browser
Species Human (GRCh38)
Location 1:29350707-29350729
Sequence AAAGCTGACCATAATGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904271126_904271134 17 Left 904271126 1:29350707-29350729 CCAACACCATTATGGTCAGCTTT No data
Right 904271134 1:29350747-29350769 CCCTACTTTCTACCTGCTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904271126 Original CRISPR AAAGCTGACCATAATGGTGT TGG (reversed) Intergenic
No off target data available for this crispr