ID: 904271764 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:29354835-29354857 |
| Sequence | CCATGGGAGAGGTTGAAGCT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 904271764_904271774 | 26 | Left | 904271764 | 1:29354835-29354857 | CCTAGCTTCAACCTCTCCCATGG | No data | ||
| Right | 904271774 | 1:29354884-29354906 | AGACCTTGGCACAGCCCTCGTGG | No data | ||||
| 904271764_904271773 | 12 | Left | 904271764 | 1:29354835-29354857 | CCTAGCTTCAACCTCTCCCATGG | No data | ||
| Right | 904271773 | 1:29354870-29354892 | CTTGTTAAGCTGCTAGACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 904271764 | Original CRISPR | CCATGGGAGAGGTTGAAGCT AGG (reversed) | Intergenic | ||