ID: 904271767 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:29354851-29354873 |
Sequence | CAAGGGCAGTAATGGGCCAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
904271767_904271773 | -4 | Left | 904271767 | 1:29354851-29354873 | CCCATGGCCCATTACTGCCCTTG | No data | ||
Right | 904271773 | 1:29354870-29354892 | CTTGTTAAGCTGCTAGACCTTGG | No data | ||||
904271767_904271774 | 10 | Left | 904271767 | 1:29354851-29354873 | CCCATGGCCCATTACTGCCCTTG | No data | ||
Right | 904271774 | 1:29354884-29354906 | AGACCTTGGCACAGCCCTCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
904271767 | Original CRISPR | CAAGGGCAGTAATGGGCCAT GGG (reversed) | Intergenic | ||