ID: 904271769

View in Genome Browser
Species Human (GRCh38)
Location 1:29354858-29354880
Sequence AGCTTAACAAGGGCAGTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904271769_904271774 3 Left 904271769 1:29354858-29354880 CCCATTACTGCCCTTGTTAAGCT No data
Right 904271774 1:29354884-29354906 AGACCTTGGCACAGCCCTCGTGG No data
904271769_904271778 24 Left 904271769 1:29354858-29354880 CCCATTACTGCCCTTGTTAAGCT No data
Right 904271778 1:29354905-29354927 GGTCCCGCCTGACCCAGTCCTGG No data
904271769_904271780 27 Left 904271769 1:29354858-29354880 CCCATTACTGCCCTTGTTAAGCT No data
Right 904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904271769 Original CRISPR AGCTTAACAAGGGCAGTAAT GGG (reversed) Intergenic
No off target data available for this crispr