ID: 904271770

View in Genome Browser
Species Human (GRCh38)
Location 1:29354859-29354881
Sequence CAGCTTAACAAGGGCAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904271770_904271778 23 Left 904271770 1:29354859-29354881 CCATTACTGCCCTTGTTAAGCTG No data
Right 904271778 1:29354905-29354927 GGTCCCGCCTGACCCAGTCCTGG No data
904271770_904271780 26 Left 904271770 1:29354859-29354881 CCATTACTGCCCTTGTTAAGCTG No data
Right 904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG No data
904271770_904271774 2 Left 904271770 1:29354859-29354881 CCATTACTGCCCTTGTTAAGCTG No data
Right 904271774 1:29354884-29354906 AGACCTTGGCACAGCCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904271770 Original CRISPR CAGCTTAACAAGGGCAGTAA TGG (reversed) Intergenic
No off target data available for this crispr