ID: 904271771

View in Genome Browser
Species Human (GRCh38)
Location 1:29354868-29354890
Sequence AAGGTCTAGCAGCTTAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904271771_904271774 -7 Left 904271771 1:29354868-29354890 CCCTTGTTAAGCTGCTAGACCTT No data
Right 904271774 1:29354884-29354906 AGACCTTGGCACAGCCCTCGTGG No data
904271771_904271778 14 Left 904271771 1:29354868-29354890 CCCTTGTTAAGCTGCTAGACCTT No data
Right 904271778 1:29354905-29354927 GGTCCCGCCTGACCCAGTCCTGG No data
904271771_904271780 17 Left 904271771 1:29354868-29354890 CCCTTGTTAAGCTGCTAGACCTT No data
Right 904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904271771 Original CRISPR AAGGTCTAGCAGCTTAACAA GGG (reversed) Intergenic