ID: 904271772

View in Genome Browser
Species Human (GRCh38)
Location 1:29354869-29354891
Sequence CAAGGTCTAGCAGCTTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904271772_904271774 -8 Left 904271772 1:29354869-29354891 CCTTGTTAAGCTGCTAGACCTTG No data
Right 904271774 1:29354884-29354906 AGACCTTGGCACAGCCCTCGTGG No data
904271772_904271780 16 Left 904271772 1:29354869-29354891 CCTTGTTAAGCTGCTAGACCTTG No data
Right 904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG No data
904271772_904271778 13 Left 904271772 1:29354869-29354891 CCTTGTTAAGCTGCTAGACCTTG No data
Right 904271778 1:29354905-29354927 GGTCCCGCCTGACCCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904271772 Original CRISPR CAAGGTCTAGCAGCTTAACA AGG (reversed) Intergenic
No off target data available for this crispr