ID: 904271774

View in Genome Browser
Species Human (GRCh38)
Location 1:29354884-29354906
Sequence AGACCTTGGCACAGCCCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904271766_904271774 15 Left 904271766 1:29354846-29354868 CCTCTCCCATGGCCCATTACTGC No data
Right 904271774 1:29354884-29354906 AGACCTTGGCACAGCCCTCGTGG No data
904271770_904271774 2 Left 904271770 1:29354859-29354881 CCATTACTGCCCTTGTTAAGCTG No data
Right 904271774 1:29354884-29354906 AGACCTTGGCACAGCCCTCGTGG No data
904271768_904271774 9 Left 904271768 1:29354852-29354874 CCATGGCCCATTACTGCCCTTGT No data
Right 904271774 1:29354884-29354906 AGACCTTGGCACAGCCCTCGTGG No data
904271769_904271774 3 Left 904271769 1:29354858-29354880 CCCATTACTGCCCTTGTTAAGCT No data
Right 904271774 1:29354884-29354906 AGACCTTGGCACAGCCCTCGTGG No data
904271764_904271774 26 Left 904271764 1:29354835-29354857 CCTAGCTTCAACCTCTCCCATGG No data
Right 904271774 1:29354884-29354906 AGACCTTGGCACAGCCCTCGTGG No data
904271767_904271774 10 Left 904271767 1:29354851-29354873 CCCATGGCCCATTACTGCCCTTG No data
Right 904271774 1:29354884-29354906 AGACCTTGGCACAGCCCTCGTGG No data
904271771_904271774 -7 Left 904271771 1:29354868-29354890 CCCTTGTTAAGCTGCTAGACCTT No data
Right 904271774 1:29354884-29354906 AGACCTTGGCACAGCCCTCGTGG No data
904271772_904271774 -8 Left 904271772 1:29354869-29354891 CCTTGTTAAGCTGCTAGACCTTG No data
Right 904271774 1:29354884-29354906 AGACCTTGGCACAGCCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904271774 Original CRISPR AGACCTTGGCACAGCCCTCG TGG Intergenic