ID: 904271775

View in Genome Browser
Species Human (GRCh38)
Location 1:29354887-29354909
Sequence GGACCACGAGGGCTGTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904271775_904271788 28 Left 904271775 1:29354887-29354909 CCTTGGCACAGCCCTCGTGGTCC No data
Right 904271788 1:29354938-29354960 AGCCTTGCTGCAACCTCGCTGGG No data
904271775_904271789 29 Left 904271775 1:29354887-29354909 CCTTGGCACAGCCCTCGTGGTCC No data
Right 904271789 1:29354939-29354961 GCCTTGCTGCAACCTCGCTGGGG No data
904271775_904271778 -5 Left 904271775 1:29354887-29354909 CCTTGGCACAGCCCTCGTGGTCC No data
Right 904271778 1:29354905-29354927 GGTCCCGCCTGACCCAGTCCTGG No data
904271775_904271780 -2 Left 904271775 1:29354887-29354909 CCTTGGCACAGCCCTCGTGGTCC No data
Right 904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG No data
904271775_904271787 27 Left 904271775 1:29354887-29354909 CCTTGGCACAGCCCTCGTGGTCC No data
Right 904271787 1:29354937-29354959 CAGCCTTGCTGCAACCTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904271775 Original CRISPR GGACCACGAGGGCTGTGCCA AGG (reversed) Intergenic
No off target data available for this crispr