ID: 904271780

View in Genome Browser
Species Human (GRCh38)
Location 1:29354908-29354930
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904271771_904271780 17 Left 904271771 1:29354868-29354890 CCCTTGTTAAGCTGCTAGACCTT No data
Right 904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG No data
904271769_904271780 27 Left 904271769 1:29354858-29354880 CCCATTACTGCCCTTGTTAAGCT No data
Right 904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG No data
904271772_904271780 16 Left 904271772 1:29354869-29354891 CCTTGTTAAGCTGCTAGACCTTG No data
Right 904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG No data
904271775_904271780 -2 Left 904271775 1:29354887-29354909 CCTTGGCACAGCCCTCGTGGTCC No data
Right 904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG No data
904271770_904271780 26 Left 904271770 1:29354859-29354881 CCATTACTGCCCTTGTTAAGCTG No data
Right 904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type