ID: 904272050

View in Genome Browser
Species Human (GRCh38)
Location 1:29356545-29356567
Sequence CAGAGCTAAGAGAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904272043_904272050 28 Left 904272043 1:29356494-29356516 CCTGCAGTGAGGAGAAAGACTGC No data
Right 904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG No data
904272042_904272050 29 Left 904272042 1:29356493-29356515 CCCTGCAGTGAGGAGAAAGACTG No data
Right 904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG No data
904272045_904272050 6 Left 904272045 1:29356516-29356538 CCTGAGAAAGGTATCAACACAGA No data
Right 904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904272050 Original CRISPR CAGAGCTAAGAGAAGGAAGG AGG Intergenic
No off target data available for this crispr