ID: 904274107

View in Genome Browser
Species Human (GRCh38)
Location 1:29369303-29369325
Sequence GCCTCTGGCCGTGTGATGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904274107_904274112 13 Left 904274107 1:29369303-29369325 CCCCGCATCACACGGCCAGAGGC No data
Right 904274112 1:29369339-29369361 ACGAGTCCCAGATGTGTGACTGG No data
904274107_904274114 15 Left 904274107 1:29369303-29369325 CCCCGCATCACACGGCCAGAGGC No data
Right 904274114 1:29369341-29369363 GAGTCCCAGATGTGTGACTGGGG No data
904274107_904274113 14 Left 904274107 1:29369303-29369325 CCCCGCATCACACGGCCAGAGGC No data
Right 904274113 1:29369340-29369362 CGAGTCCCAGATGTGTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904274107 Original CRISPR GCCTCTGGCCGTGTGATGCG GGG (reversed) Intergenic
No off target data available for this crispr