ID: 904274480

View in Genome Browser
Species Human (GRCh38)
Location 1:29371320-29371342
Sequence TCCATAAAGTCCAAATTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904274478_904274480 9 Left 904274478 1:29371288-29371310 CCTTCAATTTCAGCAAAACAGAC No data
Right 904274480 1:29371320-29371342 TCCATAAAGTCCAAATTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904274480 Original CRISPR TCCATAAAGTCCAAATTTCC TGG Intergenic
No off target data available for this crispr