ID: 904274799

View in Genome Browser
Species Human (GRCh38)
Location 1:29374128-29374150
Sequence TTTTGGGAATGGTGAGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904274797_904274799 -8 Left 904274797 1:29374113-29374135 CCATTTTGATTTGATTTTTGGGA No data
Right 904274799 1:29374128-29374150 TTTTGGGAATGGTGAGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904274799 Original CRISPR TTTTGGGAATGGTGAGAAAT AGG Intergenic
No off target data available for this crispr