ID: 904275285

View in Genome Browser
Species Human (GRCh38)
Location 1:29379795-29379817
Sequence GTTCATTCCACAGATTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904275285_904275291 18 Left 904275285 1:29379795-29379817 CCCTGGGAATCTGTGGAATGAAC No data
Right 904275291 1:29379836-29379858 GCTTAATGGCCACTCTGATTTGG No data
904275285_904275287 -9 Left 904275285 1:29379795-29379817 CCCTGGGAATCTGTGGAATGAAC No data
Right 904275287 1:29379809-29379831 GGAATGAACCTCCTACAGCATGG No data
904275285_904275293 30 Left 904275285 1:29379795-29379817 CCCTGGGAATCTGTGGAATGAAC No data
Right 904275293 1:29379848-29379870 CTCTGATTTGGTGTTTCCTTTGG No data
904275285_904275290 4 Left 904275285 1:29379795-29379817 CCCTGGGAATCTGTGGAATGAAC No data
Right 904275290 1:29379822-29379844 TACAGCATGGTGCTGCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904275285 Original CRISPR GTTCATTCCACAGATTCCCA GGG (reversed) Intergenic
No off target data available for this crispr