ID: 904275288

View in Genome Browser
Species Human (GRCh38)
Location 1:29379817-29379839
Sequence AAGCAGCACCATGCTGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904275288_904275291 -4 Left 904275288 1:29379817-29379839 CCTCCTACAGCATGGTGCTGCTT No data
Right 904275291 1:29379836-29379858 GCTTAATGGCCACTCTGATTTGG No data
904275288_904275293 8 Left 904275288 1:29379817-29379839 CCTCCTACAGCATGGTGCTGCTT No data
Right 904275293 1:29379848-29379870 CTCTGATTTGGTGTTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904275288 Original CRISPR AAGCAGCACCATGCTGTAGG AGG (reversed) Intergenic
No off target data available for this crispr