ID: 904275289

View in Genome Browser
Species Human (GRCh38)
Location 1:29379820-29379842
Sequence ATTAAGCAGCACCATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904275289_904275293 5 Left 904275289 1:29379820-29379842 CCTACAGCATGGTGCTGCTTAAT No data
Right 904275293 1:29379848-29379870 CTCTGATTTGGTGTTTCCTTTGG No data
904275289_904275291 -7 Left 904275289 1:29379820-29379842 CCTACAGCATGGTGCTGCTTAAT No data
Right 904275291 1:29379836-29379858 GCTTAATGGCCACTCTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904275289 Original CRISPR ATTAAGCAGCACCATGCTGT AGG (reversed) Intergenic
No off target data available for this crispr