ID: 904275291

View in Genome Browser
Species Human (GRCh38)
Location 1:29379836-29379858
Sequence GCTTAATGGCCACTCTGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904275286_904275291 17 Left 904275286 1:29379796-29379818 CCTGGGAATCTGTGGAATGAACC No data
Right 904275291 1:29379836-29379858 GCTTAATGGCCACTCTGATTTGG No data
904275289_904275291 -7 Left 904275289 1:29379820-29379842 CCTACAGCATGGTGCTGCTTAAT No data
Right 904275291 1:29379836-29379858 GCTTAATGGCCACTCTGATTTGG No data
904275288_904275291 -4 Left 904275288 1:29379817-29379839 CCTCCTACAGCATGGTGCTGCTT No data
Right 904275291 1:29379836-29379858 GCTTAATGGCCACTCTGATTTGG No data
904275285_904275291 18 Left 904275285 1:29379795-29379817 CCCTGGGAATCTGTGGAATGAAC No data
Right 904275291 1:29379836-29379858 GCTTAATGGCCACTCTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904275291 Original CRISPR GCTTAATGGCCACTCTGATT TGG Intergenic
No off target data available for this crispr