ID: 904277005

View in Genome Browser
Species Human (GRCh38)
Location 1:29391312-29391334
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904277000_904277005 -10 Left 904277000 1:29391299-29391321 CCGTATCCCCGGGCCCTGTCTGC No data
Right 904277005 1:29391312-29391334 CCCTGTCTGCTGCTAGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr