ID: 904282682

View in Genome Browser
Species Human (GRCh38)
Location 1:29432449-29432471
Sequence GGATATGCACAGAGGGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904282682_904282689 3 Left 904282682 1:29432449-29432471 CCCACAGCCCTCTGTGCATATCC No data
Right 904282689 1:29432475-29432497 TCATGGCCCTTAACACTGTATGG 0: 1
1: 0
2: 1
3: 11
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904282682 Original CRISPR GGATATGCACAGAGGGCTGT GGG (reversed) Intergenic
No off target data available for this crispr