ID: 904283037

View in Genome Browser
Species Human (GRCh38)
Location 1:29434640-29434662
Sequence TGCCCTGGGTATGCAATGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904283037_904283040 -8 Left 904283037 1:29434640-29434662 CCTCGCATTGCATACCCAGGGCA No data
Right 904283040 1:29434655-29434677 CCAGGGCAGACAGTGTCAATTGG No data
904283037_904283041 -2 Left 904283037 1:29434640-29434662 CCTCGCATTGCATACCCAGGGCA No data
Right 904283041 1:29434661-29434683 CAGACAGTGTCAATTGGCTTCGG No data
904283037_904283042 19 Left 904283037 1:29434640-29434662 CCTCGCATTGCATACCCAGGGCA No data
Right 904283042 1:29434682-29434704 GGCACCATTCCCGATCAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904283037 Original CRISPR TGCCCTGGGTATGCAATGCG AGG (reversed) Intergenic
No off target data available for this crispr