ID: 904283038

View in Genome Browser
Species Human (GRCh38)
Location 1:29434654-29434676
Sequence CAATTGACACTGTCTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904283038_904283046 25 Left 904283038 1:29434654-29434676 CCCAGGGCAGACAGTGTCAATTG No data
Right 904283046 1:29434702-29434724 TGGATCTCACAATCTTAACCTGG No data
904283038_904283042 5 Left 904283038 1:29434654-29434676 CCCAGGGCAGACAGTGTCAATTG No data
Right 904283042 1:29434682-29434704 GGCACCATTCCCGATCAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904283038 Original CRISPR CAATTGACACTGTCTGCCCT GGG (reversed) Intergenic
No off target data available for this crispr