ID: 904283039

View in Genome Browser
Species Human (GRCh38)
Location 1:29434655-29434677
Sequence CCAATTGACACTGTCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904283039_904283046 24 Left 904283039 1:29434655-29434677 CCAGGGCAGACAGTGTCAATTGG No data
Right 904283046 1:29434702-29434724 TGGATCTCACAATCTTAACCTGG No data
904283039_904283042 4 Left 904283039 1:29434655-29434677 CCAGGGCAGACAGTGTCAATTGG No data
Right 904283042 1:29434682-29434704 GGCACCATTCCCGATCAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904283039 Original CRISPR CCAATTGACACTGTCTGCCC TGG (reversed) Intergenic
No off target data available for this crispr