ID: 904283042

View in Genome Browser
Species Human (GRCh38)
Location 1:29434682-29434704
Sequence GGCACCATTCCCGATCAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904283037_904283042 19 Left 904283037 1:29434640-29434662 CCTCGCATTGCATACCCAGGGCA No data
Right 904283042 1:29434682-29434704 GGCACCATTCCCGATCAGCGTGG No data
904283038_904283042 5 Left 904283038 1:29434654-29434676 CCCAGGGCAGACAGTGTCAATTG No data
Right 904283042 1:29434682-29434704 GGCACCATTCCCGATCAGCGTGG No data
904283034_904283042 22 Left 904283034 1:29434637-29434659 CCTCCTCGCATTGCATACCCAGG No data
Right 904283042 1:29434682-29434704 GGCACCATTCCCGATCAGCGTGG No data
904283039_904283042 4 Left 904283039 1:29434655-29434677 CCAGGGCAGACAGTGTCAATTGG No data
Right 904283042 1:29434682-29434704 GGCACCATTCCCGATCAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904283042 Original CRISPR GGCACCATTCCCGATCAGCG TGG Intergenic
No off target data available for this crispr