ID: 904285536

View in Genome Browser
Species Human (GRCh38)
Location 1:29451240-29451262
Sequence TGCCAAGGTGAATTGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904285531_904285536 26 Left 904285531 1:29451191-29451213 CCAGTTATGTGACTTCACAGATG No data
Right 904285536 1:29451240-29451262 TGCCAAGGTGAATTGCCCTGAGG No data
904285530_904285536 27 Left 904285530 1:29451190-29451212 CCCAGTTATGTGACTTCACAGAT No data
Right 904285536 1:29451240-29451262 TGCCAAGGTGAATTGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904285536 Original CRISPR TGCCAAGGTGAATTGCCCTG AGG Intergenic
No off target data available for this crispr