ID: 904287596

View in Genome Browser
Species Human (GRCh38)
Location 1:29462182-29462204
Sequence AAGCCTGGCCGTGGTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904287596_904287607 9 Left 904287596 1:29462182-29462204 CCTGCCCCACCACGGCCAGGCTT No data
Right 904287607 1:29462214-29462236 TGGGAGCTTGACACATAGTAGGG No data
904287596_904287608 10 Left 904287596 1:29462182-29462204 CCTGCCCCACCACGGCCAGGCTT No data
Right 904287608 1:29462215-29462237 GGGAGCTTGACACATAGTAGGGG No data
904287596_904287606 8 Left 904287596 1:29462182-29462204 CCTGCCCCACCACGGCCAGGCTT No data
Right 904287606 1:29462213-29462235 CTGGGAGCTTGACACATAGTAGG No data
904287596_904287602 -10 Left 904287596 1:29462182-29462204 CCTGCCCCACCACGGCCAGGCTT No data
Right 904287602 1:29462195-29462217 GGCCAGGCTTGTGTGACCCTGGG No data
904287596_904287609 16 Left 904287596 1:29462182-29462204 CCTGCCCCACCACGGCCAGGCTT No data
Right 904287609 1:29462221-29462243 TTGACACATAGTAGGGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904287596 Original CRISPR AAGCCTGGCCGTGGTGGGGC AGG (reversed) Intergenic