ID: 904287740

View in Genome Browser
Species Human (GRCh38)
Location 1:29462831-29462853
Sequence GAGTTGCTATTGCATCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904287735_904287740 3 Left 904287735 1:29462805-29462827 CCCCAAGACAACCTCGTCCATTC No data
Right 904287740 1:29462831-29462853 GAGTTGCTATTGCATCCTGTAGG No data
904287737_904287740 1 Left 904287737 1:29462807-29462829 CCAAGACAACCTCGTCCATTCTC No data
Right 904287740 1:29462831-29462853 GAGTTGCTATTGCATCCTGTAGG No data
904287736_904287740 2 Left 904287736 1:29462806-29462828 CCCAAGACAACCTCGTCCATTCT No data
Right 904287740 1:29462831-29462853 GAGTTGCTATTGCATCCTGTAGG No data
904287733_904287740 24 Left 904287733 1:29462784-29462806 CCTGGGCCTCTCAGGTTGGGACC No data
Right 904287740 1:29462831-29462853 GAGTTGCTATTGCATCCTGTAGG No data
904287734_904287740 18 Left 904287734 1:29462790-29462812 CCTCTCAGGTTGGGACCCCAAGA No data
Right 904287740 1:29462831-29462853 GAGTTGCTATTGCATCCTGTAGG No data
904287738_904287740 -8 Left 904287738 1:29462816-29462838 CCTCGTCCATTCTCAGAGTTGCT No data
Right 904287740 1:29462831-29462853 GAGTTGCTATTGCATCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904287740 Original CRISPR GAGTTGCTATTGCATCCTGT AGG Intergenic
No off target data available for this crispr