ID: 904288109

View in Genome Browser
Species Human (GRCh38)
Location 1:29466555-29466577
Sequence GTTTCTGTGGTGACTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904288109_904288112 -10 Left 904288109 1:29466555-29466577 CCTGCTCTAGTCACCACAGAAAC No data
Right 904288112 1:29466568-29466590 CCACAGAAACCTGTGGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904288109 Original CRISPR GTTTCTGTGGTGACTAGAGC AGG (reversed) Intergenic
No off target data available for this crispr