ID: 904290325

View in Genome Browser
Species Human (GRCh38)
Location 1:29481195-29481217
Sequence GCTACAGCTTGCTACACTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904290325_904290332 0 Left 904290325 1:29481195-29481217 CCTCTAGTGTAGCAAGCTGTAGC No data
Right 904290332 1:29481218-29481240 CTGTTCCTGGGCATGTGGGTGGG No data
904290325_904290334 11 Left 904290325 1:29481195-29481217 CCTCTAGTGTAGCAAGCTGTAGC No data
Right 904290334 1:29481229-29481251 CATGTGGGTGGGCACGCAGATGG No data
904290325_904290336 30 Left 904290325 1:29481195-29481217 CCTCTAGTGTAGCAAGCTGTAGC No data
Right 904290336 1:29481248-29481270 ATGGAATCTGAGTGCTGGTGTGG No data
904290325_904290328 -5 Left 904290325 1:29481195-29481217 CCTCTAGTGTAGCAAGCTGTAGC No data
Right 904290328 1:29481213-29481235 GTAGCCTGTTCCTGGGCATGTGG No data
904290325_904290335 25 Left 904290325 1:29481195-29481217 CCTCTAGTGTAGCAAGCTGTAGC No data
Right 904290335 1:29481243-29481265 CGCAGATGGAATCTGAGTGCTGG No data
904290325_904290329 -4 Left 904290325 1:29481195-29481217 CCTCTAGTGTAGCAAGCTGTAGC No data
Right 904290329 1:29481214-29481236 TAGCCTGTTCCTGGGCATGTGGG No data
904290325_904290331 -1 Left 904290325 1:29481195-29481217 CCTCTAGTGTAGCAAGCTGTAGC No data
Right 904290331 1:29481217-29481239 CCTGTTCCTGGGCATGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904290325 Original CRISPR GCTACAGCTTGCTACACTAG AGG (reversed) Intergenic