ID: 904290328

View in Genome Browser
Species Human (GRCh38)
Location 1:29481213-29481235
Sequence GTAGCCTGTTCCTGGGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904290325_904290328 -5 Left 904290325 1:29481195-29481217 CCTCTAGTGTAGCAAGCTGTAGC No data
Right 904290328 1:29481213-29481235 GTAGCCTGTTCCTGGGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904290328 Original CRISPR GTAGCCTGTTCCTGGGCATG TGG Intergenic