ID: 904290335

View in Genome Browser
Species Human (GRCh38)
Location 1:29481243-29481265
Sequence CGCAGATGGAATCTGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904290325_904290335 25 Left 904290325 1:29481195-29481217 CCTCTAGTGTAGCAAGCTGTAGC No data
Right 904290335 1:29481243-29481265 CGCAGATGGAATCTGAGTGCTGG No data
904290330_904290335 3 Left 904290330 1:29481217-29481239 CCTGTTCCTGGGCATGTGGGTGG No data
Right 904290335 1:29481243-29481265 CGCAGATGGAATCTGAGTGCTGG No data
904290333_904290335 -3 Left 904290333 1:29481223-29481245 CCTGGGCATGTGGGTGGGCACGC No data
Right 904290335 1:29481243-29481265 CGCAGATGGAATCTGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904290335 Original CRISPR CGCAGATGGAATCTGAGTGC TGG Intergenic