ID: 904290336

View in Genome Browser
Species Human (GRCh38)
Location 1:29481248-29481270
Sequence ATGGAATCTGAGTGCTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904290333_904290336 2 Left 904290333 1:29481223-29481245 CCTGGGCATGTGGGTGGGCACGC No data
Right 904290336 1:29481248-29481270 ATGGAATCTGAGTGCTGGTGTGG No data
904290330_904290336 8 Left 904290330 1:29481217-29481239 CCTGTTCCTGGGCATGTGGGTGG No data
Right 904290336 1:29481248-29481270 ATGGAATCTGAGTGCTGGTGTGG No data
904290325_904290336 30 Left 904290325 1:29481195-29481217 CCTCTAGTGTAGCAAGCTGTAGC No data
Right 904290336 1:29481248-29481270 ATGGAATCTGAGTGCTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904290336 Original CRISPR ATGGAATCTGAGTGCTGGTG TGG Intergenic