ID: 904294285

View in Genome Browser
Species Human (GRCh38)
Location 1:29507672-29507694
Sequence TGGACTAAAAGCACCAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904294285_904294287 -2 Left 904294285 1:29507672-29507694 CCAGCGCTGGTGCTTTTAGTCCA No data
Right 904294287 1:29507693-29507715 CATCTCACAGTTTCCTTTTTAGG No data
904294285_904294289 18 Left 904294285 1:29507672-29507694 CCAGCGCTGGTGCTTTTAGTCCA No data
Right 904294289 1:29507713-29507735 AGGCTCTGTGCTGTGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904294285 Original CRISPR TGGACTAAAAGCACCAGCGC TGG (reversed) Intergenic
No off target data available for this crispr