ID: 904297296

View in Genome Browser
Species Human (GRCh38)
Location 1:29528297-29528319
Sequence GTCCCCCCATTTACTAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904297291_904297296 16 Left 904297291 1:29528258-29528280 CCAGGGGAGTGATTGGGCACATG No data
Right 904297296 1:29528297-29528319 GTCCCCCCATTTACTAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904297296 Original CRISPR GTCCCCCCATTTACTAGAGT TGG Intergenic
No off target data available for this crispr