ID: 904298843

View in Genome Browser
Species Human (GRCh38)
Location 1:29541328-29541350
Sequence ACCAGGAGAATGTGGGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904298837_904298843 9 Left 904298837 1:29541296-29541318 CCATTCCGAATGGTGTGATGTGA No data
Right 904298843 1:29541328-29541350 ACCAGGAGAATGTGGGTCATTGG No data
904298838_904298843 4 Left 904298838 1:29541301-29541323 CCGAATGGTGTGATGTGAAGAGG No data
Right 904298843 1:29541328-29541350 ACCAGGAGAATGTGGGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904298843 Original CRISPR ACCAGGAGAATGTGGGTCAT TGG Intergenic
No off target data available for this crispr