ID: 904300338

View in Genome Browser
Species Human (GRCh38)
Location 1:29549872-29549894
Sequence CCTGGCACAGGGTTGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904300329_904300338 5 Left 904300329 1:29549844-29549866 CCTGGGTATTTCCAGGGCCCAGC No data
Right 904300338 1:29549872-29549894 CCTGGCACAGGGTTGGTGTCTGG No data
904300327_904300338 11 Left 904300327 1:29549838-29549860 CCTGTTCCTGGGTATTTCCAGGG No data
Right 904300338 1:29549872-29549894 CCTGGCACAGGGTTGGTGTCTGG No data
904300331_904300338 -6 Left 904300331 1:29549855-29549877 CCAGGGCCCAGCACACGCCTGGC No data
Right 904300338 1:29549872-29549894 CCTGGCACAGGGTTGGTGTCTGG No data
904300325_904300338 21 Left 904300325 1:29549828-29549850 CCTCATGGGTCCTGTTCCTGGGT No data
Right 904300338 1:29549872-29549894 CCTGGCACAGGGTTGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904300338 Original CRISPR CCTGGCACAGGGTTGGTGTC TGG Intergenic
No off target data available for this crispr