ID: 904301123

View in Genome Browser
Species Human (GRCh38)
Location 1:29555598-29555620
Sequence CTGGGTAATCCGAGGCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904301119_904301123 30 Left 904301119 1:29555545-29555567 CCGGGGCACTTTTTGTCTGTTTT No data
Right 904301123 1:29555598-29555620 CTGGGTAATCCGAGGCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904301123 Original CRISPR CTGGGTAATCCGAGGCTTGC TGG Intergenic
No off target data available for this crispr