ID: 904301123 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:29555598-29555620 |
| Sequence | CTGGGTAATCCGAGGCTTGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 904301119_904301123 | 30 | Left | 904301119 | 1:29555545-29555567 | CCGGGGCACTTTTTGTCTGTTTT | No data | ||
| Right | 904301123 | 1:29555598-29555620 | CTGGGTAATCCGAGGCTTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 904301123 | Original CRISPR | CTGGGTAATCCGAGGCTTGC TGG | Intergenic | ||
| No off target data available for this crispr | |||||