ID: 904302117

View in Genome Browser
Species Human (GRCh38)
Location 1:29561203-29561225
Sequence CAATCTCTGGAGAAGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904302105_904302117 24 Left 904302105 1:29561156-29561178 CCTCATACCTCAATGGTGAGGTC No data
Right 904302117 1:29561203-29561225 CAATCTCTGGAGAAGGGGGATGG No data
904302104_904302117 25 Left 904302104 1:29561155-29561177 CCCTCATACCTCAATGGTGAGGT No data
Right 904302117 1:29561203-29561225 CAATCTCTGGAGAAGGGGGATGG No data
904302108_904302117 17 Left 904302108 1:29561163-29561185 CCTCAATGGTGAGGTCTGGGTCG No data
Right 904302117 1:29561203-29561225 CAATCTCTGGAGAAGGGGGATGG No data
904302102_904302117 26 Left 904302102 1:29561154-29561176 CCCCTCATACCTCAATGGTGAGG No data
Right 904302117 1:29561203-29561225 CAATCTCTGGAGAAGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904302117 Original CRISPR CAATCTCTGGAGAAGGGGGA TGG Intergenic
No off target data available for this crispr