ID: 904303531

View in Genome Browser
Species Human (GRCh38)
Location 1:29571791-29571813
Sequence TCTGCTTCATAGGATGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904303526_904303531 6 Left 904303526 1:29571762-29571784 CCTTATCTGTAACATGGAGACTG No data
Right 904303531 1:29571791-29571813 TCTGCTTCATAGGATGCTGTGGG No data
904303523_904303531 24 Left 904303523 1:29571744-29571766 CCTCGCTGTTCCTCGCATCCTTA No data
Right 904303531 1:29571791-29571813 TCTGCTTCATAGGATGCTGTGGG No data
904303524_904303531 14 Left 904303524 1:29571754-29571776 CCTCGCATCCTTATCTGTAACAT No data
Right 904303531 1:29571791-29571813 TCTGCTTCATAGGATGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904303531 Original CRISPR TCTGCTTCATAGGATGCTGT GGG Intergenic
No off target data available for this crispr