ID: 904304687

View in Genome Browser
Species Human (GRCh38)
Location 1:29580462-29580484
Sequence GGTGCTCTACTGAGCACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904304672_904304687 17 Left 904304672 1:29580422-29580444 CCCTTGCATCCTGACCAGCCTTC No data
Right 904304687 1:29580462-29580484 GGTGCTCTACTGAGCACTGGGGG No data
904304681_904304687 -1 Left 904304681 1:29580440-29580462 CCTTCTGGGGGTCCACGGATCAG No data
Right 904304687 1:29580462-29580484 GGTGCTCTACTGAGCACTGGGGG No data
904304673_904304687 16 Left 904304673 1:29580423-29580445 CCTTGCATCCTGACCAGCCTTCT No data
Right 904304687 1:29580462-29580484 GGTGCTCTACTGAGCACTGGGGG No data
904304671_904304687 18 Left 904304671 1:29580421-29580443 CCCCTTGCATCCTGACCAGCCTT No data
Right 904304687 1:29580462-29580484 GGTGCTCTACTGAGCACTGGGGG No data
904304680_904304687 3 Left 904304680 1:29580436-29580458 CCAGCCTTCTGGGGGTCCACGGA No data
Right 904304687 1:29580462-29580484 GGTGCTCTACTGAGCACTGGGGG No data
904304678_904304687 8 Left 904304678 1:29580431-29580453 CCTGACCAGCCTTCTGGGGGTCC No data
Right 904304687 1:29580462-29580484 GGTGCTCTACTGAGCACTGGGGG No data
904304670_904304687 19 Left 904304670 1:29580420-29580442 CCCCCTTGCATCCTGACCAGCCT No data
Right 904304687 1:29580462-29580484 GGTGCTCTACTGAGCACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904304687 Original CRISPR GGTGCTCTACTGAGCACTGG GGG Intergenic
No off target data available for this crispr